Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119323 Similarity: 0.970 Similarity: 0.970 Similarity: 0.968
UTR: 5HSAA119323
Gene: WDR35
MFE: -46.053
ENS: 0.864
Length: 133.
Predicted Ligands:
cobalamin - 7/20
FMN - 4/20
TPP - 3/20
RS: URS0000C2F50A_1097667
MFE: -50.783
Ligand: cobalamin
Species: Patulibacter medicamentivorans Cobalamin riboswitch
RS: URS0000ABB89E_382464
MFE: -48.111
Ligand: TPP
Species: Verrucomicrobiae bacterium DG1235 TPP riboswitch (THI element)
RS: URS0000C1FEA8_1235279
MFE: -42.516
Ligand: FMN
Species: Bhargavaea cecembensis DSE10 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119323 URS0000C2F50A_1097667 URS0000ABB89E_382464 URS0000C1FEA8_1235279
Length 133. 131. 133. 132.
Similarity - 0.970 0.970 0.968
Ensemble Norm 0.864 - - -
MFE -46.053 -50.783 -48.111 -42.516
Ligands - cobalamin TPP FMN
Gene WDR35 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 2.001 5.006
Length SE - 4. 0. 1.
Lev Distance - 30. 40. 39.
UBS 11. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 3. 1. 2. 2.
ILR 5. 4. 4. 5.
H 2. 3. 2. 1.
BL 4. 2. 4. 5.
BR 4. 4. 4. 5.
UN 0.090 0.122 0.053 0.015

Sequences

Field Description
UTR seq + 25 cagggcgacgggagcuuuccggagcugcugguacucccgauuggagacguagaaccguuacuugucgagggccuuagcggccgccgugacccucucggggaucccacgATGTTCTTCTACCTGAGCAAGAAAA
UTR dot + 25 ..((((..((((((…(((((.((((((((..(((.((((.((.((((……)))).)).)))).)))..))))))))..))).))..))))))..)..)))….(((((……..)))))……
RS 1 seq AAGGGAAGUCCGGUGAGAACCCGGCGCGGACCCGCCACUGUGAGCGCGAAGACCCGCCGCACGCACGCGUGCAGCCACUGGGAUCCGUCCCGGGAAGGCGCGGCGGCUCGGACGCGCGAGCCAGGAGACCU
RS 1 dot …((….)).(((….(((((.(((((((((((((((((.(((((……))).))…)))).)))..))….))).))))).)))))….)))…((((((……))))))………
RS 2 seq CGCAAUCCUUGGGGGCGACCUGGUAUGGGUCUGAGAUGUUUCCUUGCCGGUGGUUAACAGCCAUCUGCGCAGAAGCGGUCCCUUAGAACCUGAUCCGGUUGAUCCCGGCGUAGGAAAAGGUAAGAGUCGACCU
RS 2 dot …..(((((.(((((((((.((..((((((((((.((((((..(((.(((((((…))))))).)))..))))))….)))))).))))..))))))).)))).)…))))..((((……..))))
RS 3 seq AUUCAUCUUCGGGGCUGGGUGAAAUUCCCGACCGGCGGUGAUGGGGCAUAGGCCCCUAAGCCCGCGAGCCGCAAGGCAGGAUUUGGUGAGAUUCCAAAGCCGACAGUAAAGUCUGGAUGGGAGAAGGUGAAG
RS 3 dot .((((((((((.((((..(.(((.(((((((((.(((((..((((((.(((….))).)))).)).)))))..))……)))).))).))))..))))..)………………))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table