Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119325 Similarity: 0.970 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA119325
Gene: WDR35_0
MFE: -51.727
ENS: 0.951
Length: 141.
Predicted Ligands:
TPP - 10/20
cobalamin - 7/20
molybdenum - 1/20
 RS: URS0002321D21_1915400
MFE: -56.134
Ligand: cobalamin
Species: Streptomyces luteus Cobalamin riboswitch
 RS: URS0000C59210_870478
MFE: -56.514
Ligand: TPP
Species: Burkholderia sp. MR1 TPP riboswitch (THI element)
 RS: URS0000C455C3_92647
MFE: -52.814
Ligand: TPP
Species: Burkholderia tropica TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119325 URS0002321D21_1915400 URS0000C59210_870478 URS0000C455C3_92647
Length 141. 140. 141. 140.
Similarity - 0.970 0.968 0.967
Ensemble Norm 0.951 - - -
MFE -51.727 -56.134 -56.514 -52.814
Ligands - cobalamin TPP TPP
Gene WDR35 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 3.001 3.
Length SE - 1. 0. 1.
Lev Distance - 37. 42. 42.
UBS 11. 11. 10. 11.
BS 0. 0. 0. 0.
ILL 3. 5. 2. 3.
ILR 3. 3. 3. 3.
H 3. 3. 4. 4.
BL 3. 2. 3. 2.
BR 2. 2. 2. 3.
UN 0.050 0.064 0.078 0.071

Sequences

Field Description
UTR seq + 25 gcgguugccagggcgacgggagcuuuccggagcugcugguacucccgauuggagacguagaaccguuacuugucgagggccuuagcggccgccgugacccucucggggaucccacgATGTTCTTCTACCTGAGCAAGAAAA
UTR dot + 25 ((((((((.((((((((((((((…..((..((((..((.((((…..))))))))))..))))).))))))….))))).))))))))((((.((((…))))….)))).(((((……..)))))……
RS 1 seq GGUGUUCGCGGGCCGUGGUGGACUGCCGAAGCCAAUACGGCGACAGGAGAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUGACCGGGGAGCGGUCCCCGGGAGCCAGGAACUCUCAUCGCCGUUCUCUUCUAA
RS 1 dot ((((…((((((((((.((((.(((….(((…..(((..(…….)..)))))))))..)))).))))).)))))))))((..(((((((….)))))))..))..(((((……….)))))…….
RS 2 seq CUGCUAACGCGGGGGUCCUGCGCUGCACAUCGCGAUUCGAGUCGGCAUGACCGGUCGAAUCGCCCGUGUAUCGUGGGUGAGAAAUACCCUUUGAACCUGAUCUGGAUAAUGCCAGCGCAGGGAAGCGUUCGGGUUCGUCGG
RS 2 dot ((((….))))((((((((((.(((((…(((((((((.((((…..)))))))))))))..))))).))))))……..))))……((((..((((……))))..))))(((.(…..).)))…..
RS 3 seq CUGCUUACGCGGGGGUCCUGCGUCAUGCGCCGCUUCGAACCAUUCAUACGAAUGCUCAAGCUGCGUAUUUCGCGGGUGAGAAAUACCCUUUGAACCUGAUCUGGAUAAUGCCAGCGCAGGGAAGCGUCCGGACUUCGCAG
RS 3 dot ((((….))))((((((((((..((((((.((((.((..(((((….))))).)))))).))))))..))))))……..))))……((((..((((……))))..))))(((((…..).))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table