Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119402 Similarity: 0.943 Similarity: 0.940 Similarity: 0.937
UTR: 5HSAA119402
Gene: WDR45
MFE: -76.938
ENS: 0.861
Length: 197.
Predicted Ligands:
cobalamin - 16/20
lysine - 2/20
Mg2+ - 1/20
 RS: URS000232285C_1805278
MFE: -48.428
Ligand: cobalamin
Species: Nitrospirae bacterium CG2_30_53_67 Cobalamin riboswitch
 RS: URS000232FAF5_530564
MFE: -67.990
Ligand: cobalamin
Species: Pirellula staleyi DSM 6068 Cobalamin riboswitch
 RS: URS000231EB33_381
MFE: -78.542
Ligand: cobalamin
Species: Mesorhizobium loti Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119402 URS000232285C_1805278 URS000232FAF5_530564 URS000231EB33_381
Length 197. 196. 198. 197.
Similarity - 0.943 0.940 0.937
Ensemble Norm 0.861 - - -
MFE -76.938 -48.428 -67.990 -78.542
Ligands - cobalamin cobalamin cobalamin
Gene WDR45 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 23.007 13.004
Length SE - 1. 1. 0.
Lev Distance - 73. 68. 78.
UBS 10. 12. 14. 8.
BS 5. 4. 6. 7.
ILL 3. 4. 4. 3.
ILR 3. 3. 4. 3.
H 3. 3. 3. 3.
BL 5. 5. 5. 3.
BR 7. 7. 9. 6.
UN 0.173 0.148 0.091 0.107

Sequences

Field Description
UTR seq + 25 ggaaguagggccugauguaaacacccgagccgggcuccaaggcccgggaggucagaaaaccgggccgcgggcggcaccgacagcuggggcccgggucagggacacgcggaggucaggccggugaaggcggcaggaagcuggagcacgaucccaggaggaacaauccugcaccATGACTCAACAGCCACTTCGAGGAG
UTR dot + 25 ……..((((((((.(…..(((((.((((((((((.(((((((…………))))))).(((……)))…..)))))))))).)).)))……..).))))))))..(((((..(((..((..((((.(((.(((((…..)))….)).))).))).)..))….))).)))))…..
RS 1 seq AUAGAUUGAAUCAGGCAUAAGGUGUAAAGAAUCAGGGAAUGAAGAAGCGGAAAGAGGUGAAAAUCCUCUGCUGUCACGCAGCCGUGAAGGGAACGAAAACCCAACUAUAGCCACUGUCCUGAGCUUGUCGAAGGAUGGGAAGGCGGGUGAGUAGGCAGCCCUGAGCCGGAAGACCUCUCAUUCCCACAACCUCGAU
RS 1 dot ……….(((((((…(.((((…..(((.((..((…..((((..(((((…….))))).))))….)).)).))).(((……..)))…)))).)…)).)))))….((((.(((.((((((((.((((…..(((……..)))…..)))).)).))))))…)))))))
RS 2 seq GUAGGUGGGAAACGUGACGGGGCCCGUUGUACGGCAGCAAGCGAGGGAAGCGAAGUGAAAAACUUCCGCCGCCCCGCGACUGUAAGGGGGACGAACGCCCAGCAGAUGGCCACUGAUGCUUCGCACGAAGCGCCGGGAAGGUCGGGCAAGUAGGUCGAACCCGAGCCAGGAUAUCUUGCUCGUUGCCGAGGUUUCUUU
RS 2 dot ….(((.(((.(((..(((((((..((((…((((…(((.(((..(((((((…..))))).))..))))))..))))..(((.(…..).))).))))..)))).)))))).))).)))(((((..(((.((…(((((((((((((((….))).))….)).)))))))))).)))..)))))…
RS 3 seq AUAGUCGCUGCCGUCGUCGGUUCCGUUUUUGGAGCCAAGAGGGAAUGCGGUGAGGGCGAACUUCCUGCCCAAAGCCGUGGCUGCCCCCGCAACUGUGUGCGGUAGUCCUCCCCAAGACCACUGAGGAUUUUCCUCGGGAAGGUGGGGAAGGGCGUGGAUCCGCGAGCCAGGAGACCUGCCGGCGACAGGAUAGUUGA
RS 3 dot ……((((((((((((((((((((((.((((.(((…(((…(((((..(((((…….)))))…)))))…..)))(((((……)))))..(((((((((…(((.(((((((…)))))))…)))))))).)))).))).)))).))))..)))…..))))))))).)).))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table