Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119414 Similarity: 0.937 Similarity: 0.937 Similarity: 0.936
UTR: 5HSAA119414
Gene: WDR45_0
MFE: -78.688
ENS: 0.958
Length: 199.
Predicted Ligands:
cobalamin - 17/20
lysine - 1/20
FMN - 1/20
 RS: URS0000AB368A_318161
MFE: -58.158
Ligand: lysine
Species: Shewanella denitrificans OS217 Lysine riboswitch
 RS: URS0002320751_1218169
MFE: -67.791
Ligand: cobalamin
Species: Pseudomonas putida S11 Cobalamin riboswitch
 RS: URS0002331B22_1387277
MFE: -65.939
Ligand: cobalamin
Species: Pseudooceanicola flagellatus Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119414 URS0000AB368A_318161 URS0002320751_1218169 URS0002331B22_1387277
Length 199. 198. 200. 200.
Similarity - 0.937 0.937 0.936
Ensemble Norm 0.958 - - -
MFE -78.688 -58.158 -67.791 -65.939
Ligands - lysine cobalamin cobalamin
Gene WDR45 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19.002 11.003 16.001
Length SE - 1. 1. 1.
Lev Distance - 75. 79. 78.
UBS 9. 12. 11. 10.
BS 5. 3. 4. 8.
ILL 4. 4. 4. 3.
ILR 2. 3. 4. 4.
H 3. 3. 3. 4.
BL 4. 2. 3. 4.
BR 6. 5. 5. 6.
UN 0.161 0.111 0.110 0.125

Sequences

Field Description
UTR seq + 25 aaguagggccugauguaaacacccgagccgggcuccaaggcccgggaggucagaaaaccgggccgcgggcggcaccgacagcuggggcccgggucagggacacgcggaggucaggccggugaaggcggcaggaagcuggagcacgaucccaggguugaggaacaauccugcaccATGACTCAACAGCCACTTCGAGGAG
UTR dot + 25 ……((((((((.(…..(((((.((((((((((.(((((((…………))))))).(((……)))…..)))))))))).)).)))……..).))))))))..(((((..(((..((..((((.((……..(((((((…..))))))))).))).)..))….))).)))))…..
RS 1 seq CUUUAUGGUAGAGGUGCGCUAAUUAUAAGUAGUGAUCAGUAGGGUGAUGCCUAAGAUCGUUCACGAAAGGAGUUAGUGCCGAAGUUGAGCUAUCCAUCAUGAUCUACUGCUGGUGUUGCUGUUGAAAAAGCGCAACACUGCCAUGGUGUUUUUUAUCGGGAAGAUAGAAGAUUUUAACCGUGGAGCGCUACUGAUAGG
RS 1 dot ……..((..((((((((…….((((((((((((..(((((..((.(((..(((..(((………..))).)))..))).)))))))..).))))).))))))((((((((.(((…..))))))))))).(((((((((((((((((…..))))))))))….)))))))))))).)))..))..
RS 2 seq UCUACCAUGCCGGCCGCCGGUUUCCACCACGGAAUCAAUAGGGAAUCCCAGGCCCGCCAAUUCGGGCCAAACGGAACUGCCCCCCGCAACCUGUAGGUGCCGAGCCUGCUCCAUCAAUGCCACUGGGCCACGAACCCGGGAAGGCCGGAGCCAGGCCAUGACGCACCAGUCAGGAGACCUGCCGGCCUACAUUCACCAAC
RS 2 dot ……(((..((((((.((((((((((((((……..(((..(((..((((((……))))))….)))….)))……..)))).))))….(((((((((……(((.(((((…….)))))…))).))))).))))(.((((……))))))))))).)).))))..)))……..
RS 3 seq CAAUUAAGCGCCAUGACCGGUCCCGUUGCUUUUCGGGCGAAAGAGGGAAUGUAGUGCGGUGCCGUUUAGCGCCAAGUCUACAGCUGCCCCCGCAACUGUCAGCGGCGAGCAGGGCCAAUAUGCCACUGGAGCAAUCCGGGAAGGCUGGCCCAACGCAUUGACCCGCAAGCCAGGAGACCUGCCGGACAUGUGCCCCAUGG
RS 3 dot …….(((.((((.((((((((…((((..(((((((….(((..((((((..(((((……)))))..).)))))….)))((((……..))))…((.((((((….(((.(((((….)))))…)))))))))…)).))).)))).))))..)).))))….)).)))))))((…))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table