Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119415 Similarity: 0.937 Similarity: 0.930 Similarity: 0.926
UTR: 5HSAA119415
Gene: WDR45_1
MFE: -78.747
ENS: 0.820
Length: 207.
Predicted Ligands:
cobalamin - 15/20
FMN - 1/20
SAM - 1/20
 RS: URS0002316D38_560556
MFE: -79.297
Ligand: cobalamin
Species: Asanoa sp. 210121 Cobalamin riboswitch
 RS: URS000231FB6A_573024
MFE: -71.921
Ligand: cobalamin
Species: Roseovarius sp. NH52J Cobalamin riboswitch
 RS: URS00023126DB_1386078
MFE: -80.430
Ligand: cobalamin
Species: Pseudomonas sp. EGD-AK9 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119415 URS0002316D38_560556 URS000231FB6A_573024 URS00023126DB_1386078
Length 207. 206. 208. 205.
Similarity - 0.937 0.930 0.926
Ensemble Norm 0.820 - - -
MFE -78.747 -79.297 -71.921 -80.430
Ligands - cobalamin cobalamin cobalamin
Gene WDR45 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 29.013 9.001 32.009
Length SE - 1. 1. 4.
Lev Distance - 73. 90. 81.
UBS 6. 9. 6. 9.
BS 8. 9. 8. 10.
ILL 1. 4. 2. 2.
ILR 2. 3. 2. 1.
H 3. 3. 3. 4.
BL 4. 4. 6. 8.
BR 6. 3. 4. 6.
UN 0.237 0.121 0.264 0.141

Sequences

Field Description
UTR seq + 25 ucccucccccggaaguagggccugauguaaacacccgagccgggcuccaaggcccgggaggucagaaaaccgggccgcgggcggcaccgacagcuggggcccgggucagggacacgcggaggucaggccggugaaggcggcaggaagcuggagcacgaucccaggaggaacaauccugcaccATGACTCAACAGCCACTTCGAGGAG
UTR dot + 25 ..(((.((((……..((((((((.(…..(((((.((((((((((.(((((((…………))))))).(((……)))…..)))))))))).)).)))……..).))))))))……)).)).)))..(((((((((……(((((…….)))))…..)).)))..))))…………
RS 1 seq AUGGUCUUGGCCGCAGCUGGUUCGGCCGUCCUCACCGGAUGGCCGAGGCAACAGGGAACCCGGUGUGAAUCCGGGACUGCCCCGCAGCGGUGAGUGGGAACGACCGCCGUCAACGAAGCACUGGGCCUCGGCCUGGGAAGCGACGGCCAGUAGGAACGCGCACGACGCCCACGAGUCCGAAGACCUGCCAGUGCGCCGCAUGCCGU
RS 1 dot (((((..(((.((((.(((….(((((((((..(((…(((((((((..(((….(((((…….)))))..(((..((..((((((.((.(…).))))))))…))..)))))).))))))))))))..)).))))))).(((((….((…(((……..)))))….)))))))))))))))…)))))
RS 2 seq AAACACUGCAUCAGUGUUGGUGCCUGCCUCGGCAGGUGAAAAGGGAAUGUGCAGCCGCGCGCUAUCGCGGCCAAAGACAGCCGCCCCCGCGACCGUAAACGGAAAGGCCGAUCACAGCCACUGGCAUACGCCGGGAAGGCAGAUCGGGCGUAGGGCCAGCUGCCCUGAAUCCGCCAGCCGGGAGACCUGCCAACAUAAAAGGACGAAA
RS 2 dot ………….((((((((……((((((.((((….(((…..(((((.(.((.((((.(((((……..)))))..((….(((….)))…))((((((…(((.(((((….)))))…))).))))))..)))).))).))))))))…..)))).))))))……))))))))…………
RS 3 seq CCUGCGCGCCUUGCUUCAGGUGCCCGACGCCACGCGCGUACGAGGUGAAACAGGGAAGCCGGUACAGAAUCCGGCGCUGCCCCCGCAACGGUAGGUGAGUCAAACGCCGCUCUAUUGCCACUGUGCUUCGUGCAUGGGAAGGCGCGGCGCUAGCCCGCGAGGCUCGCUCACAAGCCCGGAGACCGGCCUGCUGCAGUCCACGGCA
RS 3 dot …(((.(((((((….((((.(((.((((.(.((.(((((((((…((((((..(((((……..)))))..(((….))).(((((((((.((…..))))).)))))))).))))))))))))).)).)..)))))))))))…..))))))).)))……(.(((..(((..((…..)).)))..)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table