Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119471 Similarity: 0.987 Similarity: 0.986 Similarity: 0.984
UTR: 5HSAA119471
Gene: WDR47
MFE: -11.323
ENS: 0.748
Length: 62.
Predicted Ligands:
fluoride - 15/20
glutamine - 5/20

 RS: URS0000C2AC15_12908
MFE: -9.428
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C1C1DD_980563
MFE: -20.075
Ligand: fluoride
Species: Methylosinus sp. R-45379 Fluoride riboswitch
 RS: URS0000DB6601_882101
MFE: -12.076
Ligand: fluoride
Species: Sinorhizobium fredii GR64 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119471 URS0000C2AC15_12908 URS0000C1C1DD_980563 URS0000DB6601_882101
Length 62. 62. 63. 62.
Similarity - 0.987 0.986 0.984
Ensemble Norm 0.748 - - -
MFE -11.323 -9.428 -20.075 -12.076
Ligands - glutamine fluoride fluoride
Gene WDR47 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.004 3.001 11.007
Length SE - 0. 1. 0.
Lev Distance - 13. 17. 18.
UBS 6. 4. 5. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 1.
H 2. 2. 2. 2.
BL 4. 2. 3. 3.
BR 4. 2. 3. 1.
UN 0.274 0.210 0.302 0.194

Sequences

Field Description
UTR seq + 25 cuggcacugagcagcaagugagcgcgaggcuaucaauATGACGGCTGAAGAAACAGTGAATG
UTR dot + 25 ((.((.((.(……..).)).)).))(((.(((…))).)))……………..
RS 1 seq UACGUUCAUCUUAACUUAUAGACGGAAGUAGACUAUUGCAACGAUAGUUGAAGGAACGCAUU
RS 1 dot (((.(((.(((……..))).))).)))((((((((…))))))))………….
RS 2 seq GGCGCGCCAGGGGAUGGGGUGCCCCCUACAACCGCCGAAGAGGCUGAUGACUCCUGCUCAAUG
RS 2 dot (((((.(((…..))).)))))…..((.(.(((…..))).).))…………..
RS 3 seq UAGGAGAGUGGGAAUGGUGUCUCCCCUUUAACCGCGCUGAUGCUGAUGACGCCUGCUGACGA
RS 3 dot ..((((((.((((……..))))))))..))(((.(.((….)).))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table