Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119537 Similarity: 0.985 Similarity: 0.984 Similarity: 0.982
UTR: 5HSAA119537
Gene: WDR61
MFE: -32.419
ENS: 0.901
Length: 101.
Predicted Ligands:
purine - 18/20
TPP - 2/20

 RS: URS0000C7F9D8_1590652
MFE: -25.717
Ligand: purine
Species: Cohnella kolymensis Purine riboswitch
 RS: URS0000C3124C_84024
MFE: -15.459
Ligand: purine
Species: Clostridium disporicum Purine riboswitch
 RS: URS0000AB5C4E_324057
MFE: -20.222
Ligand: purine
Species: Paenibacillus sp. JDR-2 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119537 URS0000C7F9D8_1590652 URS0000C3124C_84024 URS0000AB5C4E_324057
Length 101. 100. 102. 101.
Similarity - 0.985 0.984 0.982
Ensemble Norm 0.901 - - -
MFE -32.419 -25.717 -15.459 -20.222
Ligands - purine purine purine
Gene WDR61 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.018 6.006
Length SE - 1. 1. 0.
Lev Distance - 18. 18. 22.
UBS 6. 6. 4. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 0. 0. 0. 0.
H 4. 4. 3. 4.
BL 2. 1. 1. 1.
BR 2. 1. 1. 0.
UN 0.238 0.210 0.373 0.317

Sequences

Field Description
UTR seq + 25 gagcccgucuuccgacgugcagccuggcagugcagugagcugucuggccuuuuguccuugauccuugguuaaggaaATGACCAACCAGTACGGTATTCTCT
UTR dot + 25 ..((.((((….)))).)).(((.((((((…….)))))).)))……(((((((((…)))))))))……..(((…..)))…….
RS 1 seq UGCUUGGCAAGUUGUCACGCGCGUAUAUACUCGGGAAUCGGCCCGAACGUCUCUACCCGGAAACCUUAAUUUCCGGACUACGCGGCAAUCACCAAUGACA
RS 1 dot .((.(((((…))))).))((((……(((((……)))))))))……(((((((……)))))))…….((……))…….
RS 2 seq AUAAUGGUUAACAAUAACCUUCGUAUAAGCUUAAUAAUAAGGUUUAAGCGUCUCUACUAUAUCACCGUAAAUGAUAUAACUAUGAAGUCUCUGGAUCCACGA
RS 2 dot …..(((((….)))))..(((.(((((((…….))))))).)))…….(((((((…….)))))))……………………
RS 3 seq CCUAAAUAUGAUGAAAGAUCUCGUAUAUCCUCGGGAAAAAGGCCCGAAAGUUUCUACCCGAAAACCUUUAUUUUCGGACUACGAGUUGAUGGAACAAAUAU
RS 3 dot …..((((((.((….))))))))….(((((…….)))))……….(((((((……)))))))…….(((…..)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table