Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119722 Similarity: 0.969 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA119722
Gene: WDR93
MFE: -38.771
ENS: 0.848
Length: 126.
Predicted Ligands:
TPP - 10/20
cobalamin - 3/20
SAM - 3/20
 RS: URS0000DA5D63_1797273
MFE: -47.709
Ligand: molybdenum
Species: Candidatus Aminicenantes bacterium RBG_16_63_16 Moco (molybdenum cofactor) riboswitch
 RS: URS0000D94763_1805026
MFE: -48.134
Ligand: TPP
Species: Armatimonadetes bacterium 13_1_40CM_64_14 TPP riboswitch (THI element)
 RS: URS00023356AA_1801874
MFE: -36.268
Ligand: cobalamin
Species: Omnitrophica WOR_2 bacterium RIFOXYA2_FULL_45_12 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119722 URS0000DA5D63_1797273 URS0000D94763_1805026 URS00023356AA_1801874
Length 126. 126. 127. 125.
Similarity - 0.969 0.969 0.968
Ensemble Norm 0.848 - - -
MFE -38.771 -47.709 -48.134 -36.268
Ligands - molybdenum TPP cobalamin
Gene WDR93 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 8.002 3.
Length SE - 0. 1. 1.
Lev Distance - 39. 38. 41.
UBS 8. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 1. 1. 3. 2.
H 4. 4. 5. 4.
BL 2. 2. 2. 2.
BR 2. 4. 1. 1.
UN 0.127 0.151 0.079 0.136

Sequences

Field Description
UTR seq + 25 cggacuuccgguucaagccggaaguugugguuaccaaggcgacgcaacgccgcccggccagcuuuucaguuucauagagguucccagugccaccuucugugATGTCATTCCCAAGAGGAAGTCAGA
UTR dot + 25 ..((((((((((….)))))))))).(((((…..((((……))))….)))))………..((((((((((……….)))).))))))((.(.((((…..))))).))..
RS 1 seq UAAUCUUGACUGCUCCGAGUCAACAGGCCUAAAGCCCGGUCUGGGGCCAGGGCAUUUGACCGAUAGGGCGCGGCUGGAAACAGCCCCGCCUUCCGCGUUUGAAAAGGAGACAUCGUGAAGUCGUCA
RS 1 dot …..((((((……))))))…((((…((((……))))..))))….(((((..((((((.(((((….))))).)))))).)).)))……((.(((……..))).)).
RS 2 seq AGUCUUCGCUGGGGGAGCUCGGUUGAGCCGGGCUGAGAGUGCAGCCAGCACCACGGAGUGCCCUGCUGCAGAUCCCAUGAACCCGAUCCAGGUAAUGCUGGCGUGGGGAACGCAGAAAGUCGCGUGG
RS 2 dot ..(((((….)))))(((((((…)))))))((.((.((((((..((((……))))…))))))..)).))….((((..((((……))))..))))..((((……..))))..
RS 3 seq GGAAAGAGGUGGAAAUCCUCUACUAUUCGGUAACUGUAAGAGAAACGAAAGCCGGGUUAUCCACUGCCCCGCGUUAUUCCGGGGCGGGAAGGAAGGCAAGUAGGAUGAGUCUUAAGUCAGGAAAC
RS 3 dot ….(((((…….)))))…(((((((…(((…….)))…)))))))..(((.((((((((.(…..)))))))))…))).(((…(((((….))))).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table