Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119746 Similarity: 0.963 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA119746
Gene: WDTC1
MFE: -36.112
ENS: 0.967
Length: 150.
Predicted Ligands:
glucosamine - 8/20
FMN - 8/20
cobalamin - 2/20
 RS: URS0000BF4A07_1262826
MFE: -30.613
Ligand: glucosamine
Species: Clostridium sp. CAG:594 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB643F_244592
MFE: -55.480
Ligand: FMN
Species: Labrenzia alexandrii DFL-11 FMN riboswitch (RFN element)
 RS: URS0000AB9989_645991
MFE: -37.588
Ligand: glucosamine
Species: Syntrophobotulus glycolicus DSM 8271 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119746 URS0000BF4A07_1262826 URS0000AB643F_244592 URS0000AB9989_645991
Length 150. 150. 152. 149.
Similarity - 0.963 0.961 0.961
Ensemble Norm 0.967 - - -
MFE -36.112 -30.613 -55.480 -37.588
Ligands - glucosamine FMN glucosamine
Gene WDTC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 7.001 3.002
Length SE - 0. 4. 1.
Lev Distance - 49. 44. 50.
UBS 7. 8. 9. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 2. 1. 2. 2.
H 3. 4. 4. 3.
BL 3. 3. 3. 2.
BR 1. 1. 2. 0.
UN 0.173 0.247 0.211 0.221

Sequences

Field Description
UTR seq + 25 agcagacguugaccgggcgcggggggguaauuaaauguguauuuuguggaccugggcuuggcuggaaugcucagggguccugaagauccuauuauagcuuccuucuguugaaccauuaagaaaagATGGCGAAAGTCAACATAACTAGAG
UTR dot + 25 …………((((((.((((………………………)))).))))))..((((.(((..((((((…..))))))…..)))))))…((((((.(((((…….)))))……))))))………
RS 1 seq CUUAUUUAUUUAGCGCCAGGCCCAAAAGAGGGUGACGAGGACUAUGGUUAUCGAAAGAUUCGGCGGAUGCCAUAGCGGAUUUGUGAAUCGUAAGAAAUACUUUUAAAAGAUAAAAUUGAAAUUAUAACAAAGAAGUAUUUCACACAGUUA
RS 1 dot ……………….((((……))))..(((.(((….))).)))…(((((.((((((.((…..)))))))))))))….(((((((((((…..((((……..))))…..)))))))))))………
RS 2 seq AACAGUUCUCGGGGCGGGGUGAAAGUCCCCACCGGCGGUAUCAGGGAAACCUGGAGCCCGCGAGCGCCUUGGUAAGUCGUGUUUGCCGAGGGUCAGCAGAUCCGGUGAGAAGCCGGAGCCGACGGUUAUAGUCCGGAUGAUAGAGAGCUUGG
RS 2 dot …………((.((((…….)))).))…(((.(((((….))))).))).((..((.((((((((((…..))))))))))))..))..((((((…..(((((…….)))))…..))))))…………..
RS 3 seq AAGAAAAAUAUAGCGCCAGAACCUUAUCAGGUUGACGAGGAAGAGGUUAAUCGAAAAUUUCGGCGGAUGCCUCUCGGUGGCUUGUCAUCGACAGAUCGGUUCCAAAACCGAAAAGUAAUUUUUGGGACAAAAGCCGGUCAGCAAGAGAA
RS 3 dot ………….((((.(((…..((.(((((((………)))))))))….)))))))……..((((((……))))))..((((((((……(((((((….)))))))……))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table