Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119800 Similarity: 0.960 Similarity: 0.959 Similarity: 0.959
UTR: 5HSAA119800
Gene: WHAMM
MFE: -47.089
ENS: 0.833
Length: 146.
Predicted Ligands:
FMN - 7/20
cobalamin - 5/20
TPP - 3/20
 RS: URS0000D8B5B8_1798572
MFE: -39.585
Ligand: FMN
Species: Lentisphaerae bacterium GWF2_45_14 FMN riboswitch (RFN element)
 RS: URS0000C88D9E_1408103
MFE: -39.889
Ligand: lysine
Species: Bacillus campisalis Lysine riboswitch
 RS: URS0000D9577F_1528693
MFE: -53.066
Ligand: glycine
Species: Burkholderia sp. AD24 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119800 URS0000D8B5B8_1798572 URS0000C88D9E_1408103 URS0000D9577F_1528693
Length 146. 145. 147. 145.
Similarity - 0.960 0.959 0.959
Ensemble Norm 0.833 - - -
MFE -47.089 -39.585 -39.889 -53.066
Ligands - FMN lysine glycine
Gene WHAMM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 9.003 4.002
Length SE - 1. 1. 1.
Lev Distance - 49. 49. 52.
UBS 12. 13. 10. 13.
BS 0. 0. 0. 0.
ILL 3. 4. 2. 3.
ILR 2. 3. 1. 3.
H 4. 4. 3. 3.
BL 5. 3. 4. 4.
BR 5. 5. 4. 5.
UN 0.130 0.131 0.184 0.083

Sequences

Field Description
UTR seq + 25 uuccgggagcgggccuugcgcgcgcggugggucgaggcggacgcgcggcugcgccagguuauucaaggacacggaaaagccaacaccaugguagcauuaaugaacguuuaccaagaggaagATGGAGGACGAGCAGCCTGACAGCC
UTR dot + 25 .(((..(((..(((((.(((((.((.(((.(((……))).))).))))))).))))).)))..)))………((((……))))……..((..(((((.(((………))).)))))..))((……)).
RS 1 seq GUUGAUCUUCGGGGCAAGGUGCUUGUUUCGCGAAAGCGGAACGAAAUUCCUGACCGGCGGUAAAGUCCGCGAGUCCGUUGAAUAAACGAACAGACAUGGCGAAAUUCCAUGACCGACAGUAAAGUCUGGAUGAAAGAAGAUCGUG
RS 1 dot ………(((..(.(((…(((((((((….)))))))))….)))).)))((((……))))..((.((((…..)))).))…….((((..(((..(.((((((……))).)).).)..)))..)))).
RS 2 seq UCAUUCUGAGGAUAAUGAGGUCCAUUGAGGAUUGGGGAAAGGGGUAUUUGCCGAAACUUUGAGAACUCAUUCUUCUUAAAGUUGGUUCUGUGAUUGAAUAAAUGCAGAACUGUCAUAUAGGGAACUAUAUGGAGGGCUAUCUUACGC
RS 2 dot ……((((((.((((((.((((..(((..((((.(((…….))).))))..))))).)).)))))).))))))…..((((((((.(((…..))))))))))).((((((((….))))))))……………
RS 3 seq UUUUCGCACUCUGGAGAGCGGCAGUAGCCAUCUGCAAACGCAGAUUCCGGCAGGCUGCCCACCGAAGGGGCGCGCGUUUCACCGCGACACGGCAAGGUGUUCACGGCAACGCAAUCUCUCAGGUAUCGAGGACAGAGGGGCCAUG
RS 3 dot ….(((.((((((…(.((((((.(((((((((….))))))…)))..))))))).))..))))))).(((((…(((.(((((……)))).).))).)))))..((((((..((…….)).))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table