Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119837 Similarity: 0.958 Similarity: 0.952 Similarity: 0.952
UTR: 5HSAA119837
Gene: WIPF2
MFE: -40.917
ENS: 0.938
Length: 156.
Predicted Ligands:
cobalamin - 11/20
FMN - 4/20
Mg2+ - 2/20
 RS: URS000232C7A2_465541
MFE: -67.936
Ligand: cobalamin
Species: Streptomyces sp. Mg1 Cobalamin riboswitch
 RS: URS000232578E_40318
MFE: -53.445
Ligand: cobalamin
Species: Streptomyces nodosus Cobalamin riboswitch
 RS: URS0000DA4A70_75293
MFE: -64.099
Ligand: cobalamin
Species: Streptomyces autolyticus Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119837 URS000232C7A2_465541 URS000232578E_40318 URS0000DA4A70_75293
Length 156. 157. 155. 154.
Similarity - 0.958 0.952 0.952
Ensemble Norm 0.938 - - -
MFE -40.917 -67.936 -53.445 -64.099
Ligands - cobalamin cobalamin cobalamin
Gene WIPF2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 35.004 9.001
Length SE - 1. 1. 4.
Lev Distance - 54. 48. 56.
UBS 9. 10. 13. 11.
BS 0. 0. 0. 0.
ILL 4. 4. 6. 4.
ILR 4. 4. 3. 4.
H 2. 2. 1. 2.
BL 3. 3. 5. 2.
BR 0. 1. 3. 2.
UN 0.090 0.146 0.026 0.065

Sequences

Field Description
UTR seq + 25 guaucggaagaaccuggaggagagagggcguggggaaucuggggaggaguggucgaauauugguauaugaaugaccuaaagguacaaauaaagacggagagagaacagugccaacugggagcagggcaagaATGCCAATTCCTCCTCCCCCGCCAC
UTR dot + 25 …((((……))))………((((.(((((……((((((……….((((((((.((..((.((((..(((((………………….)))))…))))..))…))…)))))))))))))))))))))))..
RS 1 seq ACCUAAGAUGACCUGCGGCGGACCGCUCGGUCCGCCAUCGCCGAGGACGGCGACAUGGGAGGAAGCCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUGAACCCUGCGGAGCGAUCGGCCGGGUGAGUCAGGAACUCCCGUCGUCCUCACUGCCCGG
RS 1 dot …………….((((((((….))))))))…((.(((((((((…..(((((….((..(.((..(((((((.(((((((((………….))))…))))))))))))..))).))..))))))))))))))…))….
RS 2 seq GACCCGGCACAAGAUGUAUGCUCGUGCUCGCUGUCGCCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACUUGUGCGUGUUCGCCCCCGAGGUGUGCGCCCGAGCGUCAGUCCGAGGACCUGCCGACAGCGCGCCCGGCCG
RS 2 dot ….((((…………..((.((.((((((((..(((((….(((……..(.(((.((((…(((…((((((((((.(((….)))…)))…)))))))…))).)))))))))))))))))))))))).)).))))))
RS 3 seq AGAGGAAGCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGGCCUCCCAUCGCCUGUACGGGGUCACGGCUCGUCCGUACGGUUCGUCGCGUACGUGGGGCUGGAAGACCGGGAGGGCCGCGGAUCCGGGAGCCAGGAGACUC
RS 3 dot …….(((((…….)))))..((((((((…..((.(((((..((((((((((………….((((.((((((…((((((……..))))))..))))))…)))))))))).))))…)))))))))..)).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table