Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119986 Similarity: 0.954 Similarity: 0.953 Similarity: 0.952
UTR: 5HSAA119986
Gene: WTAP
MFE: -39.420
ENS: 0.985
Length: 174.
Predicted Ligands:
Mg2+ - 8/20
lysine - 6/20
cobalamin - 4/20
 RS: URS0000C89137_1235790
MFE: -38.239
Ligand: lysine
Species: Eubacterium sp. 14-2 Lysine riboswitch
 RS: URS0002315B40_1276229
MFE: -22.560
Ligand: cobalamin
Species: Spiroplasma syrphidicola EA-1 Cobalamin riboswitch
 RS: URS0000AB3063_641107
MFE: -35.904
Ligand: lysine
Species: Clostridium sp. DL-VIII Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119986 URS0000C89137_1235790 URS0002315B40_1276229 URS0000AB3063_641107
Length 174. 173. 175. 174.
Similarity - 0.954 0.953 0.952
Ensemble Norm 0.985 - - -
MFE -39.420 -38.239 -22.560 -35.904
Ligands - lysine cobalamin lysine
Gene WTAP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 14.004 4.005
Length SE - 1. 1. 0.
Lev Distance - 59. 56. 64.
UBS 9. 10. 10. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 1.
ILR 1. 1. 2. 0.
H 7. 7. 6. 7.
BL 0. 1. 3. 0.
BR 0. 1. 1. 1.
UN 0.184 0.191 0.246 0.115

Sequences

Field Description
UTR seq + 25 auaugcgcuggcaguuuugaucauauuacgccuggucaaggccuucggugauaccucaucacucuugucuccucgaccuggauuuuaagacucaaauccaguaccucaagcaaguccagcagccgagcguugcccaacugagaucaacaATGACCAACGAAGAACCTCTTCCCA
UTR dot + 25 …(((….)))((((((((((………))))))))))….((((((…..))))))…(((…..)))((((((((……..))))))))…(((…..(((…(((((…..)))))…))))))…………….(((((…)))))…
RS 1 seq UGAAUAGAUAGAGGUUGCGUGAUUCAUGAGUAGCUUAUCGGAUGUGACAGGCACAGAGGAUGAUAACUGAAAGGGAAGAACGCCGAAAGAAGUUCUUUUCCUGAAGAGAGAUUCUUGGGCAUAUAGUGAAUAAUUAUAUGACUGUCAUCAGUGGAUGGAGUGCUAUCAUGGAU
RS 1 dot ……((((..((((((………..))))))))))…((((…..))))……………..(((((((((..(….)..)))))))))((.((((…..)))).))((((((((…..))))))))((((….)))).(((((….)))))……
RS 2 seq AAAAAGACAAUUUAAUAAAAAUAGUUAUGUUAGAACCAGGGAAAUAAGUGAAAUUCUUAUGCUGUCCCAGCAACUGUAAUACGGAUGAAAGCCAUUAGCCACUGAAAGUAAUUUUGGGAAGGCGGCAAGUAAAAUGAUGUUAAGCCAGAAGACCUCUCUAAUAAUAAUUAGCCUA
RS 2 dot ……….(((((((……….)))))))….((((.(((((…….)))))….))))..((.((((…)))).))…(((….(((.((((((….))))))…))))))………………..(((…..)))(((((….)))))….
RS 3 seq AACUAAGAUAGAGGCGCGAAAUUUAUGAGUAGUAUUAUGGACACAAGCAUAAUGAAAUAAUACGAAAGGAACUUUCGCCGAAGUAAAUAGUAAAUUGCUUUAAUACUAUUUGCUGGUUUUAUGUAGAAUAUGCAUAAAACUGUCACAAGUGAUUUGUGGAGAGCUAUUUUCAAU
RS 3 dot .(((…(((((………))))).)))..(((((((……..)))))))……..((((((…))))))….(((((((((((………..)))))))))))(((((((((((…..)))))))))))..(((((…..)))))((((…..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table