Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119999 Similarity: 0.933 Similarity: 0.933 Similarity: 0.933
UTR: 5HSAA119999
Gene: WWC3
MFE: -62.806
ENS: 0.990
Length: 223.
Predicted Ligands:
cobalamin - 19/20
unknown - 1/20

 RS: URS000231C266_1736539
MFE: -97.241
Ligand: cobalamin
Species: Angustibacter sp. Root456 Cobalamin riboswitch
 RS: URS0002333DDA_1801840
MFE: -61.567
Ligand: cobalamin
Species: Omnitrophica WOR_2 bacterium GWA2_47_8 Cobalamin riboswitch
 RS: URS0002313970_1101195
MFE: -42.960
Ligand: cobalamin
Species: Methylophilaceae bacterium 11 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119999 URS000231C266_1736539 URS0002333DDA_1801840 URS0002313970_1101195
Length 223. 221. 223. 223.
Similarity - 0.933 0.933 0.933
Ensemble Norm 0.990 - - -
MFE -62.806 -97.241 -61.567 -42.960
Ligands - cobalamin cobalamin cobalamin
Gene WWC3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.004 16.001 4.006
Length SE - 4. 0. 0.
Lev Distance - 76. 80. 88.
UBS 15. 17. 16. 15.
BS 0. 0. 0. 0.
ILL 4. 3. 5. 3.
ILR 3. 5. 6. 4.
H 5. 5. 5. 6.
BL 4. 5. 6. 3.
BR 5. 4. 4. 5.
UN 0.103 0.041 0.130 0.179

Sequences

Field Description
UTR seq + 25 cugccgcugcccgccggcugggaggaggcgcgagacuacgacggucgcgucuuuuacauugaccacaacacgcgccagacgucguggaucgacccccgcgaccggauaacaaagccauugaccuuugccgauuguguuggggacgaacuuccuuuaggaugggaaaccguauaugauaaacaaauuggaguuuauuacATGGACCACATAAATAAACTTACCC
UTR dot + 25 .((((.((.((((…..)))).)).))))(((..(((((((((.(((((……………….)))))))….))))))).))).(((((((((.(((….(((((……..)))))))).)))))..))))(((…(((((…….)))))..)))……………..(((((((((..(((…..))).)))))))))….
RS 1 seq UAGGGUGGGUCGAUCGUUGGUUCGACCGGCUCGCCAGGUCGGUCGUCGCAAGAGGGAACCCGGUGCGAGUCCGGGACUGCCCCGCAGCGGUGAGUGNCCGCCGUCACACGCACUGGGUGCCGACCACCCGGGAAGCGACGGCCAGUAGGAGUGCGGCGCUGCACCACGCGGCCGAGCACGCGCCCACGAGUCCGAAGACCUGCCAACGUGUUUCGCCGACA
RS 1 dot …(((((((((.(((……))).))))))))).(((((.(((((((….(((..(((((…….)))))….)))….))))))).)))))((((((….((.(((((((…..)))))))…))))))))..((.((.((((((((((((…..)))))…)).)))))))))..((((((((((……..)).)))))..))).
RS 2 seq AAUCAAUUUUAUCUAUAUGGCCCUCACAGAUGAGGUUAAAAGGGAAUCCGGUGCGCCUAACGGCAAAUCCGGAACGGUCCCGCCGCUGUAAUCCGAUCCUUUUCGUUUCAAAGGGAAAAGGAGGUUUUUGGCCGCUGUAUCCACUGCUUCUUAAUUAGAGAAGCGGGAAGGAAAGUCAAAAACUUAGGAAAGUCAGAAGACCUGCCUUAUAGUUAUAAUGUUU
RS 2 dot ….((((((((((…((…..)).))))))))))….((((.(((((…(((….)))….)))))….))))((.(((..((.((..((((((((.((….)).)))))))))).))..))).))….(((.(((((((((…..)))))))))…)))……..((((.(((…(((….)))…)))…))))………
RS 3 seq UUACAUUAACGUCACUACGGUUUUCAACUUUUAAUCAAACGUUGAAAUAAAAGGGAAUUCGGUACGGGUUAACAUGUAAUGUCUAACCUCAAGCCAAAGCUGCCCCCGCAACUGUAAUUAGCGAGUUGUUUUGAUUAGCUGCCACUGCAUUGUUUGAUGUGGGAAGGCCUAAAAACAAUGAAGACCUAAGAGCCAGGAGACCUGCCGUCAGUAUUUUCACCUU
RS 3 dot ………(((….)))..(((((((.(((….))).)))))))………….(((..((((((((((…)))).))))))…)))..(((((…..((((((((…..)).))))))……)))))(((.(((((((….)))))))…)))……….((((((…..(((.((((…)))).).))….))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table