Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120087 Similarity: 0.987 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA120087
Gene: XAF1
MFE: -12.201
ENS: 0.738
Length: 62.
Predicted Ligands:
fluoride - 15/20
cobalamin - 4/20
purine - 1/20
 RS: URS0000CA35F2_1331910
MFE: -20.329
Ligand: fluoride
Species: Thermogutta terrifontis fluoride (crcB) riboswitch
 RS: URS0000BF8F19_1889813
MFE: -17.643
Ligand: cobalamin
Species: Anaerolineaceae bacterium oral taxon 439 Cobalamin riboswitch
 RS: URS0000DB09B3_698762
MFE: -17.460
Ligand: fluoride
Species: Thermanaeromonas toyohensis ToBE Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120087 URS0000CA35F2_1331910 URS0000BF8F19_1889813 URS0000DB09B3_698762
Length 62. 63. 63. 62.
Similarity - 0.987 0.986 0.986
Ensemble Norm 0.738 - - -
MFE -12.201 -20.329 -17.643 -17.460
Ligands - fluoride cobalamin fluoride
Gene XAF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 3.076 1.001
Length SE - 1. 1. 0.
Lev Distance - 16. 17. 19.
UBS 3. 2. 4. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 0. 1. 1.
H 2. 2. 3. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.403 0.492 0.127 0.371

Sequences

Field Description
UTR seq + 25 aaacgaaacucaaccgaaagccugcagagagcagaacATGGAAGGAGACTTCTCGGTGTGCA
UTR dot + 25 …………………((((…..)))).(((((((((….)))))..))))…
RS 1 seq UGCGCGGUAGGAGUCAUCAGCCCGAUAGGGCAUUUAGCGGGGGACUCCAUCCCCGUCAACUUU
RS 1 dot ……………….((((….))))…..((((((……..))))))…….
RS 2 seq GAAAUCGGUGUGAAUCCGAUACUGACCCGCAGCCGUGAAAGCGAGCCCGCUUAAGACGGACCA
RS 2 dot …(((((…….))))).(((…..)))((((..(((((….)))))…))))….
RS 3 seq UAUAAAAGUGGCGAUGGAGCUCGCCUAAUGCUCAGGUUUGAGCUAAUGGCUCCUACCGUAAU
RS 3 dot ………(((((……)))))………(((..(((((…)))))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table