Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120172 Similarity: 0.959 Similarity: 0.957 Similarity: 0.954
UTR: 5HSAA120172
Gene: XPNPEP1
MFE: -32.085
ENS: 0.895
Length: 165.
Predicted Ligands:
SAM - 8/20
Mg2+ - 7/20
unknown - 2/20
 RS: URS000219213A_649161
MFE: -34.510
Ligand: cobalamin
Species: Pseudoalteromonas sp. 3J6 Cobalamin
 RS: URS0000E606C1_86332
MFE: -49.057
Ligand: unknown
Species: Mogibacterium pumilum raiA RNA
 RS: URS0000C82131_1473546
MFE: -36.486
Ligand: Mg2+
Species: Lysinibacillus sp. BF-4 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120172 URS000219213A_649161 URS0000E606C1_86332 URS0000C82131_1473546
Length 165. 166. 163. 164.
Similarity - 0.959 0.957 0.954
Ensemble Norm 0.895 - - -
MFE -32.085 -34.510 -49.057 -36.486
Ligands - cobalamin unknown Mg2+
Gene XPNPEP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 7.002 4.004
Length SE - 1. 4. 1.
Lev Distance - 51. 49. 59.
UBS 12. 12. 12. 13.
BS 0. 0. 0. 0.
ILL 4. 2. 3. 4.
ILR 3. 3. 5. 2.
H 3. 4. 3. 4.
BL 3. 4. 4. 3.
BR 4. 4. 3. 5.
UN 0.127 0.145 0.086 0.067

Sequences

Field Description
UTR seq + 25 gucaccgccgaauggcagccuccagaaagccaccgcgaguaagggugaaucaccaggauuuucaacugagaaauuuaagaauaauugaaccuaacgaggugacacacucaggagacacagguguggaaacagacggcagaATGTGGACTGACGGGCGCTACTTTC
UTR dot + 25 …(((((.(..((((…………))))).))).))..(((((..((((((((…(((((……………….))))))))…..)))))..)))))……….(((((…..(((.(.(((…))).).)))….)))))……
RS 1 seq CUUGCUAAACACUUCAACGGUGUGAUUUUUUUAGUAGGAUAAUCGGGAAGUUGGUGCGUUUUCAUUGAUGAAGUCAAUCCCAACACUGCCCCCGCAACGGUAAAGUUAUGCUGUAUUAAAUUAUGGUAACUGAGUCCGGAGACCGGCCUUGAUGUAAUCUUACUAA
RS 1 dot (((((((((((((…..)))))…….))))))))…..((((…..((((.(((…((((((…))))))…))).).)))))))..((((((……))))))……….(((.((.(((.((((…)))).)))…)).)))…….
RS 2 seq UAAGGUCAUGUUCGUGGUUGAAAGUCCAAGCCAGCUACGGGCAAAGGGAUCCACGUAAGCUGCUGCGGAGACGGCAGUGAUCAUGGCGUAGCUUAGAAGUAAGUCCUCCGGGAAACUCGGGUUAAGGCAAGUGUGGGGUCAAAAACCAGGUCGAGUGGCCUUG
RS 2 dot ……..((((((((((((………..))))))))))))..(((((..((.((((((((.((.(.((((….)).)).).))))))))))…))..)))))..(((..(((((((((..(((………)))…))))….)))))..)))..
RS 3 seq AUAUUUCCUCGUUAGGUGAGGCUCCUAUAUGAAGAUAUGCUGCUGCCCAGAAACGUCCAAAGACGCCAAUGGGUCAACAGAAGUCAUCGACUUAAGGUGAUUUUUAAUGUAGCUGGAAGAAUCCUAUGUCAUAUAGUGCUAAAACUCUACGAAAGAGGCUUCUA
RS 3 dot ((((((..((((((((…….)))).)))))))))).(((.((((((….((((….))))….)))).)).)))((((((((…….))))))))……….((((((…(((…((.((.(((……))).)).))…)))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table