Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120173 Similarity: 0.954 Similarity: 0.952 Similarity: 0.952
UTR: 5HSAA120173
Gene: XPNPEP1_0
MFE: -39.952
ENS: 0.857
Length: 174.
Predicted Ligands:
cobalamin - 13/20
lysine - 5/20
TPP - 1/20
 RS: URS0002324AC2_871968
MFE: -42.440
Ligand: cobalamin
Species: Desulfitobacterium metallireducens DSM 15288 Cobalamin riboswitch
 RS: URS0002326AC6_1795872
MFE: -37.759
Ligand: cobalamin
Species: Colwellia sp. Phe_37 Cobalamin riboswitch
 RS: URS000233196A_759412
MFE: -43.255
Ligand: cobalamin
Species: Natranaerobius trueperi Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120173 URS0002324AC2_871968 URS0002326AC6_1795872 URS000233196A_759412
Length 174. 174. 175. 174.
Similarity - 0.954 0.952 0.952
Ensemble Norm 0.857 - - -
MFE -39.952 -42.440 -37.759 -43.255
Ligands - cobalamin cobalamin cobalamin
Gene XPNPEP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.006 14.003 9.001
Length SE - 0. 1. 0.
Lev Distance - 55. 55. 60.
UBS 13. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 4. 4. 3. 3.
ILR 3. 3. 3. 4.
H 4. 5. 6. 3.
BL 4. 2. 2. 5.
BR 3. 1. 2. 2.
UN 0.149 0.224 0.206 0.126

Sequences

Field Description
UTR seq + 25 cgaauggcagccuccagaaagccaccgcgaguaagcccugacgugggcuggggcacgucaccgcggugaaucaccaggauuuucaacugagaaauuuaagaauaauugaaccuaacgaggugacacacucaggagacacagacggcagaATGTGGACTGACGGGCGCTACTTTC
UTR dot + 25 ….(((……)))….(((.((…….(((((……))))))))))..(((.((..((((..((((((((…(((((……………….))))))))…..)))))..))))..)).))).(((.(.(((…))).).)))……………
RS 1 seq UGAACAUCAUAUUUAAUAGGUGCCCGCAAGGGACAAUAGGGAACCAGGUUGAAUUCCUGGACGGACCCACCACUGUAAUUAGAUGAUGAAAAUGUGCAUUAGCCACUGGGAUAACCGGGAAGGCGUACAUCGGAGUCUAUAAGUCAGGAGACCUGCCUAUAAAAUAUCGCCAAA
RS 1 dot ….((((……….))))(((….)))……(((..(((((…….)))))…..)))………..(((((..(((…(((((….(((.((((…..))))…)))))))))))..)))))..((.((((…)))).))…………….
RS 2 seq ACGGCUCAAAAUUGCUUAGGUGCUCGAUAUUUAUACGUUAUUUACGUAAAAAUGAAGAGAUAAUCGGGAAGUUAGUGAACUGCUGCAAGCAUAAUUCUAACGCUGCCCCCGCAACGGUAAUACUUUGUUAUUAACAAAGUUAAGCCCGGAGACCGGCCUAAUCAACAUAAAAUUA
RS 2 dot ..(((……..)))……(((..(((((.(((((…..))))).)))))..)))……(((..(((((…..((((…))))…..)))))….)))(((…)))….((((((((…))))))))..((.((((…)))).))…………….
RS 3 seq AAUAUAGAGUGGCUUUUAGGUGUAAUCAUUUUUAAAAGGGAAUCAGGUGAAAAUCCUGAGCGGUCCCGCCACUGUAACUGGGAUUGAAGAUUUAAUUAACCACUGGGUUUAAUCCGGGAAGGUAAAUCUUCUUAUACCAGAAGCCAGGAAACCUGCCUAUUAGCUGUACUCAAU
RS 3 dot ….((.((((((……………………((((.(((((…….)))))….)))))))))).)).((((..(.((((((((…..(((.((((((…))))))…)))))))))))..)..)))).((.((((…)))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table