Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120460 Similarity: 0.956 Similarity: 0.955 Similarity: 0.953
UTR: 5HSAA120460
Gene: XRCC4
MFE: -34.424
ENS: 0.951
Length: 153.
Predicted Ligands:
FMN - 13/20
SAM - 2/20
Mg2+ - 1/20
 RS: URS0000C5E878_1736413
MFE: -51.240
Ligand: SAM
Species: Nocardioides sp. Soil797 SAM riboswitch (S box leader)
 RS: URS0000D9443B_1798288
MFE: -42.056
Ligand: FMN
Species: Gammaproteobacteria bacterium RIFCSPHIGHO2_12_FULL_45_12 FMN riboswitch (RFN element)
 RS: URS0000C23430_1736380
MFE: -54.939
Ligand: FMN
Species: Rhizobium sp. Leaf453 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120460 URS0000C5E878_1736413 URS0000D9443B_1798288 URS0000C23430_1736380
Length 153. 153. 152. 151.
Similarity - 0.956 0.955 0.953
Ensemble Norm 0.951 - - -
MFE -34.424 -51.240 -42.056 -54.939
Ligands - SAM FMN FMN
Gene XRCC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.010 7. 7.007
Length SE - 0. 1. 4.
Lev Distance - 56. 57. 55.
UBS 9. 11. 10. 11.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 3.
ILR 1. 3. 1. 2.
H 3. 4. 5. 3.
BL 4. 4. 3. 5.
BR 2. 2. 2. 2.
UN 0.242 0.144 0.237 0.159

Sequences

Field Description
UTR seq + 25 cgggauuuagaucacgucccgcaggccggcggaaguagcugauacucucauugguugcaaaaccuugaucugugaaagcgggcguuuuggaagauaccggaaguagagucacggagagguauuaagaaATGGAGAGAAAAATAAGCAGAATCC
UTR dot + 25 ((((((………))))))((.(((((.((.((((…..)))).)).)))))))….(((((..(((((((……((.((((((……))))))))….))))))))))))……………………………
RS 1 seq AGCUCAUCGAGAGGGACUGAGGGAACGGCCCAGUGAAGUCCCGGCAACCGCCACGAGCCCCCUGCUCCGCCCACCAGAAACCCGGGCGGGACCAGUCGUGGAAACGGUGCUAAUUCCGGCCCACGGCGAGAUACGACGCGGGGAAGAUGAGAA
RS 1 dot ..(((…))).((((((..(((…..)))…..))))))(((.((((((((((…..(((.(((((((………..)))))))..)))))))))…)))))))……..(((.((.((…..)).)).)))………..
RS 2 seq UAUUAUCUUCAGGGCGGGGUGCAACUCCCCACCGGCGGUGUUUUUGCUAACCCAGCAAAUCAGCCCGCGAGCGCCUUUUCUCACGAAAAGGGUCAGCAGAUUUGGUGCCAAUCCAAAGCCGACGGUGAAAGUCCGGAUGAAAGAAGAAAUAG
RS 2 dot …………((.((((…….)))).)).((((.(((((((((…..))))))..)))))))…..(((((((….)))))))(((.((…(((((…….))))))).)))((…….))………………
RS 3 seq CCUUGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAGGGUUUUUGCCCAAGCCCGCGAGCGCCCAACGGCAUGUUGCGCCUUAGGGUUAGCAGAUCCGGUGUGAUUCCGGGGCCGACGGUUACAGUCCGGAUGAAAGAGAAUGAGC
RS 3 dot ….((((.(.((((.(((((((((.(((.(((…)))..))))))))))))..))))).))))((((..(((…((((((((…(((((….))))))))))))).)))))))…(((…….)))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table