Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120461 Similarity: 0.950 Similarity: 0.948 Similarity: 0.948
UTR: 5HSAA120461
Gene: XRCC4_0
MFE: -47.103
ENS: 0.942
Length: 200.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000231D9C8_1379909
MFE: -52.271
Ligand: cobalamin
Species: Rufibacter sp. DG15C Cobalamin riboswitch
 RS: URS0002321037_1476
MFE: -47.027
Ligand: cobalamin
Species: Sporosarcina psychrophila Cobalamin riboswitch
 RS: URS000231C733_46506
MFE: -54.133
Ligand: cobalamin
Species: Bacteroides stercoris Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120461 URS000231D9C8_1379909 URS0002321037_1476 URS000231C733_46506
Length 200. 200. 199. 199.
Similarity - 0.950 0.948 0.948
Ensemble Norm 0.942 - - -
MFE -47.103 -52.271 -47.027 -54.133
Ligands - cobalamin cobalamin cobalamin
Gene XRCC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 4.009 10.002
Length SE - 0. 1. 1.
Lev Distance - 66. 67. 64.
UBS 12. 12. 11. 12.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 3.
ILR 2. 3. 3. 3.
H 4. 4. 4. 3.
BL 3. 3. 2. 5.
BR 4. 3. 3. 2.
UN 0.165 0.195 0.261 0.206

Sequences

Field Description
UTR seq + 25 cgggauuuagaucacgucccgcaggccggcggaaguagcugauacucucauugguugcaaaaccuugaucugugaaagcgggcguuuuggaagauaccggaaguagagucacggagagguaggauccggaaguggggcugccucuuuaaauaacaaaaaucugagguauuaagaaATGGAGAGAAAAATAAGCAGAATCC
UTR dot + 25 ((((((………))))))((.(((((.((.((((…..)))).)).)))))))((((((((((..((…..)))))).))))))…(((((((((………..((((((((((..((((….)))).))))))))))…………)))..))))))…………………………
RS 1 seq ACCUUUGCCCCAGAUUUUGGUGACAGACUCGGCUACCGCCGAUGAUGUCUUAAAAGGGAAUCAGGUGUAAAACCUGAGCUGUUCCCGCAACUGUUAUCUUCCAUUACAAGCUGCCCACCGCAUGCCACUGUCUGUUCACCAGAUGGGAAGGCCGGCCAGCCGAAGAGAGCCAGGAGACCUGCCAACGUCCACAAUUCACC
RS 1 dot …………..((((((.((((…(((((….)))))…))))))))))(((((((((((…..))))))….)))))……(((.(((((……..((((….(((…(((.(((((((…..)))))))…)))))).)))).))))).)))((((…))))……………….
RS 2 seq UGAAUAUGUGUAAAAAUAGGUGCGGAUUAAUACUGAUGUAUUGGUCUGCUUAAAAGGGAAGUUCGGUGAGAAUCCGACGCUGUCCCGCAACUGUAAAUGGGAGCGAUUUCGUUUAAACCACUGCUUUUUAUAAAAAAGUGGGAAGGUACGAAUAGCAAUGAUCAUUAGCCAGGAGACCUGCCUCUUUUUAUAACACAUG
RS 2 dot …………………((((((((((((….))))))))))))……(((((((((((…….)))).))).))))……((.(((((..((…(((((….(((.(((((((((…)))))))))…))))))))..))…..))))).))((((…))))……………….
RS 3 seq CUAUCUUUGCCGGCGUUUUGUUUCGCGUUCUCUAUCCGGAGAAGCGGAUGAAAAGGGAAUCGGGUGAAAGUCCCGAACAGUCCCGCUGCUGUGAGUUCCAUGCUCGGUGUAUCAUACUUGUGCCACUGUUCUUCGGAAAGAACGGGAAGGCGAUGUACCGGGAACGAGUCAGAAGACCUGCAAAACAAAGUUGAAAAAU
RS 3 dot ……………(((((.(((((.((((((….)))))))))))))))).((((.(((((…….)))))….)))).((.((((..(((((…..(((((((((……..(((.((((((((….))))))))…)))))))))))))))))..).))).))……………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table