Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120463 Similarity: 0.932 Similarity: 0.930 Similarity: 0.929
UTR: 5HSAA120463
Gene: XRCC4_1
MFE: -75.763
ENS: 0.930
Length: 242.
Predicted Ligands:
cobalamin - 19/20
lysine - 1/20

 RS: URS0002322663_688245
MFE: -95.432
Ligand: cobalamin
Species: Comamonas testosteroni CNB-2 Cobalamin riboswitch
 RS: URS0000C09BE4_1577792
MFE: -59.026
Ligand: lysine
Species: Terrisporobacter othiniensis Lysine riboswitch
 RS: URS000232B548_63
MFE: -100.837
Ligand: cobalamin
Species: Vitreoscilla filiformis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120463 URS0002322663_688245 URS0000C09BE4_1577792 URS000232B548_63
Length 242. 242. 241. 242.
Similarity - 0.932 0.930 0.929
Ensemble Norm 0.930 - - -
MFE -75.763 -95.432 -59.026 -100.837
Ligands - cobalamin lysine cobalamin
Gene XRCC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16.006 13.013 13.008
Length SE - 0. 1. 0.
Lev Distance - 84. 86. 89.
UBS 12. 15. 14. 13.
BS 0. 0. 0. 3.
ILL 4. 3. 4. 5.
ILR 4. 4. 6. 5.
H 5. 6. 5. 5.
BL 3. 5. 2. 4.
BR 1. 2. 3. 1.
UN 0.182 0.107 0.066 0.091

Sequences

Field Description
UTR seq + 25 cuccagccguccgguugggcuugucacggcaccgccuaccaagacgggcgguuaagacacuaggauaggcuccucuccaccggaaaaggcgggauuuagaucacgucccgcaggccggcggaaguagcugauacucucauugguugcaaaaccuugaucugugaaagcgggcguuuuggaagauaccggaaguagagucacggagagguauuaagaaATGGAGAGAAAAATAAGCAGAATCC
UTR dot + 25 ..((((((….))))))(((((((..((.(((((((……..)))))))…….))..)))))))…..(((.((((…..(((((((………)))))))…)))).))).(((((((((……)))))))))…(((((..(((((((……((.((((((……))))))))….))))))))))))……………………………
RS 1 seq UUACAAUGGGCGUCUGUUGGUGCUCGAGGCCGCUUUUCUGUGGUCUCAGUUCAACGGGAAGCAGGGAGGUGCUGGCCAGACACACUGGCACACCGAACCUGCGCUGCCCCCGCAACGGUCGGCGAAUGGAGUGCGCAGCACUCCUCCUUUUCCAUUCAUAGCCACUGGCGCUUGCGUGCUGGGAAGGCUGGCAAAAGGAAGAAUCGCCUAGCCCGGAUACCGGCCAACAUGGGUUGCCUGCA
RS 1 dot …………((((((((.(((.((((((((……)))))))))))))))))))..(((((..((((…(((((…..))))).))))…)))))..((((.(((…)))..))))…(((((((…)))))))(((((((((……((((.(((((((….)))))))…)))))).)))))))……((.(((((((…………..)))))))…)).
RS 2 seq ACCUAAGGUAGAGGUGCUGUACUUAAUAGUACUAAUAUAUAGCUGGCGAGCAAUUAUAUGUUGGGAAAGGAAUUAUGGCCGAAGGUAAUUUAUAGGCAUAUGAAUUAUCUGGACUUAUGCAAAAUAUGUAUAAGGCUGUCACUUUUAUUCGUAGAAGCAAAUAUAACAAUAGACCUGUUUUCACGUCUGUUGGUUAUAUGAGCAAAACGGAUUUUUCUAUAAGUGUUGAGCUACAAGGUUU
RS 2 dot ((((…….))))((((((……….(((((((((((((….)))…))))))))))………))))))…((((((((((((….))))))))))))…((((((((…..))))))))(((..(((((.(((((((….((..((((((((((((((.((….)).)))))))).))))))..))…)))))……)).)))))…)))……….
RS 3 seq GCUACCAUGCGGGCCGUUGGUGCCUGGGCCUCUGCAUCGUCAGGGCUUGGGGUAAACGGGAAGCAGGAAGGUUCACUCCACCGGAGUCCGCCCAGCCUGCGCUGCCCCCGCAACGGUCAGCGGUUGAAAACCUUGCGGUUUUCUCCUUCGUGCCUCUUCGGUCACUGUGGGCGUGAUGCCUGCGGGAAGGCCGCACGAAGUGCCCCGCCAGCCCGGAUACCGGCCAACAACGGGGUGUGUCG
RS 3 dot ((((((.(((((((((((..(((((.((((.(((……)))))))..))))))))))…(((((..(((..(((((…)))))..)))…)))))……))))))..))).)))….(((((((….)))))))..((((((((……((((.((((((((…..))))))))…))))))))))))(((((((…..((((…))))…….)))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table