Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120464 Similarity: 0.976 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA120464
Gene: XRCC4_2
MFE: -20.599
ENS: 0.987
Length: 105.
Predicted Ligands:
TPP - 13/20
purine - 5/20
Ni/Co - 1/20
 RS: URS0000DB13BA_225345
MFE: -16.345
Ligand: purine
Species: Clostridium chromoreductans Purine riboswitch
 RS: URS0000C5698D_29363
MFE: -11.987
Ligand: purine
Species: Clostridium paraputrificum Purine riboswitch
 RS: URS0000C303BA_1144342
MFE: -36.041
Ligand: TPP
Species: Herbaspirillum sp. YR522 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120464 URS0000DB13BA_225345 URS0000C5698D_29363 URS0000C303BA_1144342
Length 105. 105. 104. 105.
Similarity - 0.976 0.972 0.972
Ensemble Norm 0.987 - - -
MFE -20.599 -16.345 -11.987 -36.041
Ligands - purine purine TPP
Gene XRCC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.018 1.012 6.
Length SE - 0. 1. 0.
Lev Distance - 32. 36. 36.
UBS 5. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 0. 0. 0. 2.
H 3. 3. 3. 3.
BL 0. 1. 0. 0.
BR 2. 2. 2. 1.
UN 0.181 0.314 0.288 0.171

Sequences

Field Description
UTR seq + 25 accggaaguagagucacggagagguaggauccggaaguggggcugccucuuuaaauaacaaaaaucugagguauuaagaaATGGAGAGAAAAATAAGCAGAATCC
UTR dot + 25 .(((((…….)).)))((((((((..((((….)))).))))))))…………..((((………………………..))))….
RS 1 seq AAAAACUAAAUAAUAUUCACUUGUAUAAAUUCAACGAUAUGGGUUGAGUGUUUCUACCAAGCUGCCGUAAAUUGCUAUAGGGCUAUAAGUGUCUGCUAAAGAAUU
RS 1 dot ………..(((((((((((((((……….)))))))).)))))))………..(((.((……..)).)))……..(((…..)))…
RS 2 seq AUUUAAAAUAAAUUGUUCACUUAUAUAAAUCCUACAAUAUGGGUUGGAUGUUUCUACCGAGUUACCGUAAAUUACUCUGGGCUAUAAGUGUCUGCUAAGUAUAU
RS 2 dot …………..((((((((((((……….)))))))).))))…….((((((………..)))).))((………..))………
RS 3 seq UCGUACCGCUAGGGGUCCUGGCAGCCGCAACCGGCUGGCCGGGUGAGAAAUACCCUUGAACCUGAUCUGGAUAAUGCCAGCGAAGGGAAGCAACCGGCAGCAAGA
RS 3 dot ………((((((((((((((((((….)))))).)))))……..)))))))..(((…((((……))))…)))…((……..))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table