Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120475 Similarity: 0.953 Similarity: 0.953 Similarity: 0.949
UTR: 5HSAA120475
Gene: XRCC5
MFE: -52.787
ENS: 0.833
Length: 165.
Predicted Ligands:
Mg2+ - 5/20
Mn2+ - 5/20
FMN - 5/20
 RS: URS0000AB729D_697284
MFE: -38.764
Ligand: Mg2+
Species: Paenibacillus larvae subsp. larvae DSM 25430 M-box riboswitch (ykoK leader)
 RS: URS0000AB3CF5_279010
MFE: -46.858
Ligand: Mg2+
Species: Bacillus licheniformis ATCC 14580 M-box riboswitch (ykoK leader)
 RS: URS0000BFA90D_1221996
MFE: -53.345
Ligand: glucosamine
Species: Quasibacillus thermotolerans glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120475 URS0000AB729D_697284 URS0000AB3CF5_279010 URS0000BFA90D_1221996
Length 165. 165. 165. 165.
Similarity - 0.953 0.953 0.949
Ensemble Norm 0.833 - - -
MFE -52.787 -38.764 -46.858 -53.345
Ligands - Mg2+ Mg2+ glucosamine
Gene XRCC5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 6. 16.006
Length SE - 0. 0. 0.
Lev Distance - 62. 61. 60.
UBS 13. 12. 12. 11.
BS 0. 0. 0. 0.
ILL 5. 5. 4. 4.
ILR 3. 2. 4. 2.
H 4. 4. 5. 3.
BL 0. 1. 1. 3.
BR 4. 3. 3. 4.
UN 0.067 0.055 0.048 0.145

Sequences

Field Description
UTR seq + 25 acgguuuccccgccccuuucaggccuagcaggaaacgaagcggcucuuuccgcuaucugccgcuuguccaccggaagcgaguugcgacacggcagguucccgcccggaagaagcgaccaaagcgccugaggaccggcaacATGGTGCGGTCGGGGAATAAGGCAG
UTR dot + 25 …((((((..(((…….)))……))))))..(((((……)))))((((((((..(((((((((….)).)).).))))))))))))….(((………(((((…(((((((..(…..)..)).))))))))))……..)))..
RS 1 seq GCUAGUCUCCGUUAGGUGAGGCUCCUGUAUAGAGAAAUGCUACUGCCCAAAAAUGUCGAGAGACGCCAAUGGGUCAACAGGAAUGGUCGAAAAGAAGGCCCCUCUUAAUGUAGCUGGUUUUAAACCUAUGCUGUACAGUGCUAAAACUCAACGAAGGAGAGGUUA
RS 1 dot ….((((((…..).)))))((((((……………((((((….((((….))))….)))).))))))))..((((……..))))((((((..(((.(..(((((((…….((……..)))))))))).)))…))))))…
RS 2 seq ACAGCUCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAAUCAUCGAUCUAAGGUGAUUUUUAAUGCAGCUGGCAUGCUGCCUAUGCCAUACAGUGCUAAAGCUCUACGAUGGAAGGCGUUA
RS 2 dot .(((((((((((((((…….)))).)))))))…))))..(((((….((((….))))….)))))((..((((((((((…….))))))))))..))((((……))))(((…((((..((.((….)).))…)))).)))…..
RS 3 seq UUUUUUUACAAAGCGCCUGAACUAGCAGGAGAGCGCCUGGCUAGUUGACGAGGAGGAGGUUUAUCGAGUGUUCGGCGGAUGCCUCCCGGUUGCUCCGUACAACCGUUAGUCCUUUCUUAAAGCACAAAGGCAACUUUGUGUACAAAGGGAAUGGAAAUGCGGAUC
RS 3 dot ……………..(.((((((((((……)))).)))))).)((.(((((..((((.((((….)))).)))).)))))))…..((((((…(((((..((((((……((((((((….))))))))..)))))))))))…))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table