Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120483 Similarity: 0.979 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA120483
Gene: XRCC5_0
MFE: -24.591
ENS: 0.995
Length: 90.
Predicted Ligands:
TPP - 8/20
cobalamin - 4/20
SAM - 3/20
 RS: URS0000ABB666_545696
MFE: -18.786
Ligand: SAM
Species: Holdemania filiformis DSM 12042 SAM riboswitch (S box leader)
 RS: URS00023229D6_1805827
MFE: -29.732
Ligand: SAM
Species: Rhodococcus sp. MTM3W5.2 SAM riboswitch (S box leader)
 RS: URS0000BA406C_658057
MFE: -29.268
Ligand: TPP
Species: Roseovarius sp. HDW-9 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120483 URS0000ABB666_545696 URS00023229D6_1805827 URS0000BA406C_658057
Length 90. 89. 91. 89.
Similarity - 0.979 0.979 0.979
Ensemble Norm 0.995 - - -
MFE -24.591 -18.786 -29.732 -29.268
Ligands - SAM SAM TPP
Gene XRCC5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 7.014 2.002
Length SE - 1. 1. 1.
Lev Distance - 26. 25. 27.
UBS 7. 7. 6. 7.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 4.
ILR 2. 1. 0. 2.
H 2. 2. 2. 2.
BL 1. 1. 2. 1.
BR 2. 2. 2. 1.
UN 0.089 0.146 0.209 0.135

Sequences

Field Description
UTR seq + 25 agcgaguugcgacacggcagguucccgcccggaagaagcgaccaaagcgccugaggaccggcaacATGGTGCGGTCGGGGAATAAGGCAG
UTR dot + 25 …((.((((……)))).))…(((………(((((…(((((((..(…..)..)).))))))))))……..)))..
RS 1 seq UUUUUAUCAAGAAUGAGGGAGAGAGUCAGCUCGACGAACUCAUACCAACCUGCUUGGAAGCAAGGUGGUAAUGCUGGCAACGAUAAGAA
RS 1 dot ((((..(((….)))..))))..(((((((………..((((.(((((((….)))).)))))))).))))))………..
RS 2 seq GCACCAUCUCGAGCGGCCGAGAGAUCCGGCUUGUUGACGCCGCAGCAACCAGUCCGAAGGGGACGGGUGCUACCGCCGGAACCGAUGGAAG
RS 2 dot ……(((((……)))))..((((((..((………(((.(((.((((…..)))).)))))))).))))))………..
RS 3 seq UGCGCGCACCAGGGGCGCCUAACGGCUGAGAAGUACCCUUUGAACCUGAACCAGAUAAUGCUGGCGGAGGGAGGGUCGAAGCCACAGAU
RS 3 dot .((((.(…..).))))…..((((..((….(((((….(((…((((……))))…))))))))))..))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table