Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120517 Similarity: 0.989 Similarity: 0.986 Similarity: 0.984
UTR: 5HSAA120517
Gene: XRCC6
MFE: -31.257
ENS: 0.799
Length: 109.
Predicted Ligands:
SAM - 18/20
Ni/Co - 1/20
preQ_1 - 1/20
 RS: URS0000C7D169_929562
MFE: -24.212
Ligand: SAM
Species: Emticicia oligotrophica DSM 17448 SAM-I/IV variant riboswitch
 RS: URS0000C6E445_1246484
MFE: -34.999
Ligand: SAM
Species: Halobacillus sp. BAB-2008 SAM riboswitch (S box leader)
 RS: URS0000C129CD_926556
MFE: -24.774
Ligand: Ni/Co
Species: Echinicola vietnamensis DSM 17526 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120517 URS0000C7D169_929562 URS0000C6E445_1246484 URS0000C129CD_926556
Length 109. 108. 110. 109.
Similarity - 0.989 0.986 0.984
Ensemble Norm 0.799 - - -
MFE -31.257 -24.212 -34.999 -24.774
Ligands - SAM SAM Ni/Co
Gene XRCC6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.002 5.002 14.005
Length SE - 1. 1. 0.
Lev Distance - 13. 16. 18.
UBS 4. 5. 6. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 2.
H 3. 3. 3. 3.
BL 1. 1. 1. 2.
BR 1. 1. 1. 1.
UN 0.358 0.398 0.309 0.284

Sequences

Field Description
UTR seq + 25 guaggaaggggcggggcuuugccgaagggggcggggcucucgcugauggguuggcuuucgucagggacauagguagaagcugguATGAAGAAGCAGAGGAAGAACAAGA
UTR dot + 25 ………….((((((((((……))))))))))((.((((((((……)))))))).))………..(((……….)))……………
RS 1 seq UAUCGGUAUCAAGAAUUUCUGAGAAAAAUCUCAGAAAACCAACCGAGUCAAAACACUACGGUGGUCAAAAAGAUGCGGACUGUUCUUAAGUCAAAAAUGUUUUAUUUU
RS 1 dot ……………(((((((((….)))))))))(((.(((((((……))).)))))))…………((((…….))))…………….
RS 2 seq UUCUUAUCCAGAGAGGUGGAGGGACUGGCCCUUUGAAGCCUCAGCAACAGGUCUGAAUGCAGACACUGUGCUAAUUCCAGCGGGUGUUGAAUAACCCUGAUAGAUAGGAG
RS 2 dot …………(((((((((((…..))))))…)))))(((.(((((((((….))))).)))))))………((((……..))))………….
RS 3 seq GAUUUAUACAGAAGAGGCGAGAGACCAGGCUCUGCGACCCUCUGGCAACCAUUCGAGACAGCGAAAAGGUGCCAAUACCUGCCCAAAAAAAUUGAGGGAACUAUAAAUU
RS 3 dot ………….((((((((((……)))).))..))))((((.(((.((((……))))..)))))))…….(((………..)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table