Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120608 Similarity: 0.989 Similarity: 0.989 Similarity: 0.987
UTR: 5HSAA120608
Gene: YIF1B
MFE: -22.341
ENS: 0.749
Length: 70.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS0000AB3D92_1435356
MFE: -29.736
Ligand: cobalamin
Species: Rhodococcus pyridinivorans SB3094 Cobalamin riboswitch
 RS: URS0002333A69_710696
MFE: -31.675
Ligand: cobalamin
Species: Intrasporangium calvum DSM 43043 Cobalamin riboswitch
 RS: URS0000AB608C_999541
MFE: -30.452
Ligand: cobalamin
Species: Burkholderia gladioli BSR3 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120608 URS0000AB3D92_1435356 URS0002333A69_710696 URS0000AB608C_999541
Length 70. 70. 70. 69.
Similarity - 0.989 0.989 0.987
Ensemble Norm 0.749 - - -
MFE -22.341 -29.736 -31.675 -30.452
Ligands - cobalamin cobalamin cobalamin
Gene YIF1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3.002 7.
Length SE - 0. 0. 1.
Lev Distance - 12. 14. 14.
UBS 6. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 1. 1. 1.
H 3. 3. 3. 3.
BL 1. 0. 0. 0.
BR 1. 0. 1. 0.
UN 0.114 0.114 0.157 0.116

Sequences

Field Description
UTR seq + 25 cacgagaucaaggaucuggaacccugaggugugcacagcgcugggATGCACCCGGCAGGCTTGGCGGCGG
UTR dot + 25 ..(.(((((…))))).).(((….))).(((..(((((((((…..))))))..)))..)))….
RS 1 seq AAUCCGGUGGAAAGCCGGAGCGGUCGCGCCACUGUAACCGGAGAUGUCGAAAUCUCCGGAAGCCAGAAAA
RS 1 dot ..((((((…..))))))(((….)))..(((…((((((((……))))))))….)))….
RS 2 seq GGAACCCGGUGAGAGUCCGGGACGGUCGCGCCACUGUGACCGGUCGCACCUGCGGCCGGGAGUCAGAUAC
RS 2 dot ….(((((…….)))))..(((…))).((((..((((((((….))))))))..).)))….
RS 3 seq GGAAGCCGGUGCGAAGCCGGCGCGGUCGCGCCACUGUAACCGGGGAGCCGGCCUUCCCGGAAGCCAGAC
RS 3 dot ….((((((…..))))))(((….)))..(((…((((((((…..))))))))….)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table