Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120630 Similarity: 0.946 Similarity: 0.944 Similarity: 0.943
UTR: 5HSAA120630
Gene: YIPF1
MFE: -76.294
ENS: 0.806
Length: 193.
Predicted Ligands:
cobalamin - 13/20
FMN - 4/20
lysine - 2/20
 RS: URS00022BD393_2845820
MFE: -63.487
Ligand: cobalamin
Species: Rhizobium sp. CECT 9324 Cobalamin
 RS: URS0000C4E3CC_1774745
MFE: -88.870
Ligand: Mn2+
Species: Cupriavidus sp. UYMMa02A yybP-ykoY manganese riboswitch
 RS: URS0002326023_1986717
MFE: -33.512
Ligand: cobalamin
Species: Flavobacteriaceae bacterium TMED48 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120630 URS00022BD393_2845820 URS0000C4E3CC_1774745 URS0002326023_1986717
Length 193. 193. 192. 193.
Similarity - 0.946 0.944 0.943
Ensemble Norm 0.806 - - -
MFE -76.294 -63.487 -88.870 -33.512
Ligands - cobalamin Mn2+ cobalamin
Gene YIPF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7.011 11.
Length SE - 0. 1. 0.
Lev Distance - 69. 70. 70.
UBS 15. 16. 15. 12.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 3.
ILR 3. 4. 2. 3.
H 5. 6. 5. 4.
BL 5. 7. 4. 5.
BR 4. 4. 6. 3.
UN 0.119 0.109 0.016 0.130

Sequences

Field Description
UTR seq + 25 uccggcuuccggcaacugggcuggaccgaaaccggcgcggagcaacugaggcccgagccuucucgggacccgggggacgccuaaccccgcgagggcggagagguuccgccccccggaucaacccugcaaauuuucuuccucauaauugggagaagacucacuggccgaATGGCAGCAGTAGATGACTTGCAAT
UTR dot + 25 ((((((..((((…))))))))))((((….(((.(((.((…….))))).)))…))))((.(((((((.((…((((((((….))))…)))).)).))))))).))………..(((((((((……..)))))))))((.(((((((….)))..))))))…………
RS 1 seq CUACAAGAUUGACGAUCAGGUGCCCGCAGUCUUGCGGGAGAAUCGGGAAGCCGGCGCAAAUCCGGCACGUGCCCAACGCUGUAAGGUGGAUGCGCGCGCAAGGGGAAACCCGGCCACUGGUGGACAAGACCGGGAAGGCGGCGUGUGCAGCAGAUGCCAAGUCAGAAGACCGGCCUGAUGAGAUAGACUUGCC
RS 1 dot …((((((((.((……….))))))))))((((.(..((((….))))..)…))))((.(((((….((((….))))…))))).))..(((….)))(((..(((.((.(((.(.(((……)))).))).)).)))..)))..(((((………)))))…………..
RS 2 seq GCGGCUUCCAUUGGGGAGUAGCCGCCCUGUUCUGACCGCGCCGCGCAAUGCGGAAUCCGGAAGACAGGGGCGUACGUCAACAGACUUGACCGCUUGCGGUUAUGGCGUACGCAGCUCCGGACCCGGCUGGCCUUGCGGCCCAGCCCGAUCCAAGGCCUGGCGAGACCGAUGACCAUACCUUUCUGGCCGGGC
RS 2 dot .((((((((…..)))..)))))(((((.(((..(((..((((…..))))….))).))))))))((((((((((…….((((((….))))))))))))))))..((..(((.(.((((((((….)))).)))).).))).))(((((((.(((…………….))).)))))))
RS 3 seq NNCUAANUUUGUNNUNAAGGUUCUUAUUAGUUUAAGAUNAAGAGGGAAUUUGGUUAAAAUCCAAAACUGUACCCGNAACUGUNNGCUUAGUCCCNAGGGACAUUUUAAUUCUUCUAGAGCCACUGUCGAUUNNUUGAUGGGAAGGUGAAUUAAAAAUGNAAGUCAGGAGACCUGCCUUUGANGUUUAAUGUUU
RS 3 dot ((((((((((.(………(((((……)))))……).))))))))))…………(((.(((…((((……))))…..))))))(((((((((…….(((.(((((((….)))))))…)))))))))))).(.((((.((((…)))).)))).)…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table