Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120645 Similarity: 0.963 Similarity: 0.958 Similarity: 0.957
UTR: 5HSAA120645
Gene: YIPF2
MFE: -68.557
ENS: 0.812
Length: 155.
Predicted Ligands:
cobalamin - 9/20
molybdenum - 4/20
TPP - 3/20
 RS: URS0000C8136F_308745
MFE: -46.455
Ligand: TPP
Species: Aspergillus rambellii TPP riboswitch (THI element)
 RS: URS0000AB6401_1338
MFE: -37.450
Ligand: Mg2+
Species: Streptococcus intermedius M-box riboswitch (ykoK leader)
 RS: URS0000ABC9AD_660122
MFE: -55.926
Ligand: TPP
Species: Nectria haematococca mpVI 77-13-4 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120645 URS0000C8136F_308745 URS0000AB6401_1338 URS0000ABC9AD_660122
Length 155. 154. 154. 156.
Similarity - 0.963 0.958 0.957
Ensemble Norm 0.812 - - -
MFE -68.557 -46.455 -37.450 -55.926
Ligands - TPP Mg2+ TPP
Gene YIPF2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 8.004 6.003
Length SE - 1. 1. 1.
Lev Distance - 45. 51. 53.
UBS 11. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 2.
ILR 3. 1. 2. 1.
H 4. 4. 4. 4.
BL 4. 5. 3. 3.
BR 4. 3. 2. 4.
UN 0.142 0.117 0.208 0.083

Sequences

Field Description
UTR seq + 25 cggguaggcgagacgcgcaggcgcagagagccccagccacgccggcccagguggccucaggugagggggggcggagcgcaccuguggggacgggacgacgaguucaagccuccgugggugcaguuggucgATGGCATCGGCCGACGAGCTGACCT
UTR dot + 25 .(.((..(((…..)))..)).)…..(((((..((.((((((((…..))))…)))).)).)))))…..((((((((((((.(.((((…..))))..).)))))))))))).((((((((((…))))))))))……….
RS 1 seq CUCGCGCAUGACAGGUGUUCGACUUGAGUCGGCUGUGUUCUGGUUAGAUAUCAAGAGAAAUCUAAACAGAGCACAGCAGGCCGGUUGUUCUGAGAUUAUACUGUCACAACUUGAUCUAGAUAAUACUAGCGAAAGGACAUGCGCUGCAUUGAUU
RS 1 dot .(((.((((…..)))).)))…..(((.(((((((((((..(((((.((….)).)))))..))))))))))).)))..((((.(((.((((((………….)))))))))))))..(((((……….)))))……..
RS 2 seq AUGAAAAAUCGGUAGGUGAGGCUACCAUAGGGAUACGGAUGACUACCGCAAAGUAGUGGAGACACUAUGCGCUGGUUAGCAGUUGAGAUCGCUAAGGUUUUGACUAAUGUCAUUUCACUGCCCUACGGAGUUAAAGCUUGAACGGAACACAAGA
RS 2 dot ……….(((((……)))))………….((((((.((((…(((((….))))))))).))))))((((.((((((.((…(((….)))…)).))))))))))((….((((….))))….))………
RS 3 seq GCGGCUCACUACGGGCGCUGAGUCGAAGUAUCGUCGGCAUCCAACCUCGAGAGUUACAACUCGAGGAGAUGCUGACGUGCAGAGGCAAAGCUGAGAUUGUACCGUAAAUACUCGAUCAAGUUAAUGCUUGCGUGGGAAAAGUGUUGCCGCUCCAGA
RS 3 dot .((((((((…….).)))))))..(((.((((((((((…(((((((……..))))))).)))))))))))))..(((((.((((..(((((………….))))).))))..)))))..((((.((…..)).))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table