Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120657 Similarity: 0.956 Similarity: 0.951 Similarity: 0.950
UTR: 5HSAA120657
Gene: YIPF2_0
MFE: -81.412
ENS: 0.903
Length: 189.
Predicted Ligands:
cobalamin - 17/20
FMN - 1/20
glucosamine - 1/20
 RS: URS00023197E5_1629714
MFE: -39.523
Ligand: cobalamin
Species: Peptococcaceae bacterium BRH_c23 Cobalamin riboswitch
 RS: URS000231BA59_1803453
MFE: -72.746
Ligand: cobalamin
Species: Acidobacteria bacterium 13_1_40CM_4_58_4 Cobalamin riboswitch
 RS: URS0002333D89_7159
MFE: -66.740
Ligand: cobalamin
Species: Aedes aegypti (yellow fever mosquito) Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120657 URS00023197E5_1629714 URS000231BA59_1803453 URS0002333D89_7159
Length 189. 189. 188. 189.
Similarity - 0.956 0.951 0.950
Ensemble Norm 0.903 - - -
MFE -81.412 -39.523 -72.746 -66.740
Ligands - cobalamin cobalamin cobalamin
Gene YIPF2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 10.001 4.005
Length SE - 0. 1. 0.
Lev Distance - 56. 58. 65.
UBS 14. 14. 14. 15.
BS 0. 0. 0. 0.
ILL 4. 4. 2. 4.
ILR 3. 5. 5. 2.
H 4. 4. 5. 5.
BL 6. 5. 5. 6.
BR 2. 2. 2. 3.
UN 0.058 0.101 0.090 0.132

Sequences

Field Description
UTR seq + 25 agguagggcugggggccgagggaccggcucgggggcgggggggaagugugccugaccggucucuguccucagcgagggaugcggagacgccccugaacgaccauggcaucggccgacgagcugaccuuccaugaauucgaggaggccacuaaucuucuggcugaATGGCATCGGCCGACGAGCTGACCT
UTR dot + 25 …….(((((((((..(((((((((.(((((.(((………))).))))))))))))))))))))))).((((..(((….)))))))…(((.(((((..(((((……)))))….)))))…)))(((.(((……((.((.((((((……)))))))).)))))..)))
RS 1 seq AUUCAAUAUUAGGUAAUGAGUGAUUUUUUUCUAAGGAAAAGAAUUUAAAAGGGAAGUCAGUUAAAAUCUGACGCGGUCUCGCCACUGUCAUAGGGAGUUGCCUCACAAAGUGUCACUGGAUUUUAUCUGGGAAGACGUGGGGUAAUGAUGAACUAAAGCCAGGAAACCUGCUCAUUUCAGAUCAACACA
RS 1 dot ……..((((((..(((.((((((((((.((((……..))))..)))))))))).)))..))))))……(((.((………)))))(((((((((…((.(..((((((…))))))..).)))))))))))(((((((….((.((((…))))))…))))..)))…..
RS 2 seq CACAUUCACCGCGGACUUCGUGCUCGGGAAGACGGUUCCAAGCCGUCGCCGCCGCGCGACUGUAAGGCGGAAGUCGCUCACCUUGUGAGCGCUUGAAAAAAAGUUCGCAGACCACUGCUCUUUCGCGGGAAGGCUGCGAGCUGGUAGUACCGCCAAGCCAGGAGACCGGCGAAGUCUGCAGCCUGUGC
RS 2 dot ……..((((..((.((((((.(((…(((((((…))))))).)))..))))))..))…))))(((.(((((((…))))))))))……..((((((((.((.((((……))))…))))))))))((((……)))).((((((((((…….))))….)))).))
RS 3 seq GAAACUGCCUCGGGGGUGAAACGGGAAACCCGGUGACGCAAUUAAUGCUAUCCCGGUGCUGCCCCCGCAACGGUAAGCGCUGUGUCAUGCCUCAAGCCACUGGAUCUUUGGAUCUGGGAAGGCGGCAUGUUCGGCAGGGAUGCCCUGCCCCGCGCGAGCCCGGAGACCGGCCUUUCGGAUUCCAUGUGC
RS 3 dot ……….(((((((…..((.(…((((.((.(((…..)))..))))))).)))))))))(.(((((….)))))).((((((….(((.((((((……))))))…)))))))))…(((((((…)))))))(((…(((.((((…)))).))).)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table