Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120680 Similarity: 0.963 Similarity: 0.961 Similarity: 0.960
UTR: 5HSAA120680
Gene: YLPM1
MFE: -62.348
ENS: 0.944
Length: 149.
Predicted Ligands:
FMN - 9/20
glycine - 4/20
cobalamin - 4/20
 RS: URS0000AFBA41_1247936
MFE: -54.191
Ligand: glycine
Species: Paraburkholderia ribeironis Glycine
 RS: URS0000C08502_1125712
MFE: -51.744
Ligand: FMN
Species: Olsenella profusa F0195 FMN riboswitch (RFN element)
 RS: URS000232FED7_1877
MFE: -62.464
Ligand: cobalamin
Species: Micromonospora echinospora Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120680 URS0000AFBA41_1247936 URS0000C08502_1125712 URS000232FED7_1877
Length 149. 151. 148. 150.
Similarity - 0.963 0.961 0.960
Ensemble Norm 0.944 - - -
MFE -62.348 -54.191 -51.744 -62.464
Ligands - glycine FMN cobalamin
Gene YLPM1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 11.002 6.002
Length SE - 4. 1. 1.
Lev Distance - 41. 44. 49.
UBS 13. 13. 14. 13.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 3.
ILR 5. 3. 4. 4.
H 3. 3. 3. 3.
BL 7. 6. 5. 5.
BR 3. 3. 5. 4.
UN 0.060 0.040 0.108 0.

Sequences

Field Description
UTR seq + 25 guuuacacgcuccggggccuguaggcgccgcgaguuccggcugucgccgucgccgccgcggcuccuggaggucgguugcgacgaguaacggcgccaggacgagcccugcgccuucuuuuucgauATGTACCCGAATTGGGGCCGGTATG
UTR dot + 25 …….(((.(((..((((.((((.((((((.((..((((….))))..))…)))))).)))).)))))))..))).((((.((.((((.((((……))))))))…)).))))((((…(((……)))…)))).
RS 1 seq UUUUCGCACUCUGGAGAGCGGCAGUAGCCAUCUGCGUCGUUUGUAUCGUGCAGGCACAGGCAGGCUGCCCACCGAAGGGGCGCGCGUUUCACCGUGACGAAUCCAGAUUCUCACGGCAGCGCAAUCUCUCAGGUAUCGAGGACAGAGGGGU
RS 1 dot ….(((.((((((…(.((((((.(((.((((((.((…….))))))))….)))..))))))).))..))))))).(((((…((((((.((((….)))))))))).))))).(((((((..((…….)).)))))))
RS 2 seq CAUCAGUUUCAGGGCGGGGUGAGAGUCCCCACUGGCGGUAAGUGGCCGCACGCCGUGAGCCACGAGUCCGCGCACCGCGAUGAAAAGAGCGGUUGACCUGGUGAGAGUCCAGGACCAACGGUCAUAGUCCGGAUGAGAGAAACGGAGG
RS 2 dot ……(((((..((((((((.((.((….((.(((((..(((….)))))))).))….)).))))).).))))..)))))…((.((((.(((((…….)))))..)))).))…..((((..(…..)..))))..
RS 3 seq UGGCGGGGCCGACACUGUGGCCACAACUCCAGACGUGAACACGCGUGGGGGAAGUCCGGUCGAAUUCCGGCGCUGGCCCGCAACGGUAGGCCGUCCAGGGGAUGAACCCUGGCGGCGAGCCCGAAUACCCGCCGUGUCCGCGAAUCCCGC
RS 3 dot ..((.((((((.(.((((((((((..((((..(((((….))))).))))..))..)))))…..))).).))))))))…(((..((((.((((((……))))))))))..)))((.((((…..)))).))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table