Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120770 Similarity: 0.987 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA120770
Gene: YOD1
MFE: -14.756
ENS: 1.
Length: 72.
Predicted Ligands:
fluoride - 10/20
homocysteine - 5/20
glycine - 3/20
 RS: URS0000C6F420_1263065
MFE: -7.485
Ligand: glycine
Species: Clostridium clostridioforme CAG:132 Glycine riboswitch
 RS: URS0002305B0B_219649
MFE: -18.068
Ligand: fluoride
Species: Paraburkholderia unamae Fluoride
 RS: URS0000E5FA5C_1484158
MFE: -12.092
Ligand: aminoglycoside
Species: Pantoea sp. PSNIH1 putative aminoglycoside riboswitch / attI site
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120770 URS0000C6F420_1263065 URS0002305B0B_219649 URS0000E5FA5C_1484158
Length 72. 70. 72. 71.
Similarity - 0.987 0.985 0.985
Ensemble Norm 1. - - -
MFE -14.756 -7.485 -18.068 -12.092
Ligands - glycine fluoride aminoglycoside
Gene YOD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.053 5.049 3.008
Length SE - 4. 0. 1.
Lev Distance - 13. 19. 19.
UBS 2. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 1. 2. 0. 2.
H 1. 1. 2. 1.
BL 0. 0. 0. 0.
BR 0. 0. 1. 0.
UN 0.458 0.229 0.236 0.366

Sequences

Field Description
UTR seq + 25 ccgcaccgaagcgucgcgauaacugcaaccacccgcaacuucucgcgATGGAAACATTACATATAATTTATT
UTR dot + 25 ………..((((((((….(((……..)))…..))))))))………………….
RS 1 seq GGACGAAACUCUGGAAAGCGAUAGCACCGACGAAGCCAAAUCUUUCAGGUACAAAGACAGAGCGCAUGAA
RS 1 dot ……..((((((((((…..((………))…..)))))………..)))))……..
RS 2 seq GUUGUUUGCGGAGAUGGCAUCCUCCCUUAACCGCCGCGUCGUCUCCAUGUGGCUAAUGAUGCCUACCAGUCC
RS 2 dot ………(((((((((……………….)))))))))..(((((…….))).))……
RS 3 seq GGAGCAGCAACGAUGUUACGCAGCAGGGCAGUCGCCCUAAAACAAAGUUAGGCAUCACAAAGUACAGCAUC
RS 3 dot ………..((((((..((…(((((….)))))……..))..))))))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table