Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120790 Similarity: 0.982 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA120790
Gene: YPEL5
MFE: -32.488
ENS: 0.844
Length: 103.
Predicted Ligands:
TPP - 7/20
glycine - 7/20
purine - 5/20
 RS: URS0000C66C8E_284581
MFE: -21.038
Ligand: purine
Species: Bacillus koreensis Purine riboswitch
 RS: URS0000AB3D9D_439292
MFE: -28.633
Ligand: purine
Species: Bacillus selenitireducens MLS10 Purine riboswitch
 RS: URS0000D8158F_1423773
MFE: -31.410
Ligand: TPP
Species: Lactobacillus namurensis DSM 19117 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120790 URS0000C66C8E_284581 URS0000AB3D9D_439292 URS0000D8158F_1423773
Length 103. 102. 102. 103.
Similarity - 0.982 0.978 0.977
Ensemble Norm 0.844 - - -
MFE -32.488 -21.038 -28.633 -31.410
Ligands - purine purine TPP
Gene YPEL5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3. 4.001
Length SE - 1. 1. 0.
Lev Distance - 22. 28. 29.
UBS 7. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 2. 1. 0.
H 3. 3. 3. 3.
BL 2. 2. 1. 3.
BR 3. 2. 2. 2.
UN 0.097 0.127 0.118 0.126

Sequences

Field Description
UTR seq + 25 gagcgacaagccgcuggcagccgcggaucucaccgccgcucaggagaucuguugguuuuuagaacuucagccauaaaaATGGGCAGAATTTTCCTTGATCATA
UTR dot + 25 .((((……))))….((.((((……)))).))((((((((((((((.(((((((…………))))))).))))))..)))))).))…..
RS 1 seq UCAAUAGAAAUUACUAUAUGUCGUAUAAUAUUGGGGAUAUGGCCCAAAAGUUUCUACCGAGCUGCCGUAAAUAGCUUGACUACGAGAUAUUUGGUUAGAAUC
RS 1 dot …((((……))))..(((((((..(….)..)))))))(((((.(((((((.(((((((…….)))))))..)).))))).)))))……..
RS 2 seq ACGCAUAACGUGAACACGCUUCGUAUAUCUCCGGAAAUAGGGUCCGGAAGUCUCUACCGGGUGACCGUAAAUCACCCGACUAUGAAGGUGGCUUUGACCCUC
RS 2 dot .(((…..)))…….((((……..))))…((((((..(((((((((.((((((((…….)))))))…..).))).)))))))))))).
RS 3 seq AUCUAACACUAGGGGUGCCCGUCACGGGCUGAGAUGCAGAGCUGCGAUCCCUUGGAACCUGUUCAAGUUAAGACUUGCGAAGGGAACGUGUUUUGUGGAAACA
RS 3 dot ((((……..))))(((((…)))))……(((((((.(((.((((((.(……..(((((….)))))).)))))).))))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table