Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120831 Similarity: 0.956 Similarity: 0.954 Similarity: 0.952
UTR: 5HSAA120831
Gene: YWHAB
MFE: -46.391
ENS: 0.860
Length: 167.
Predicted Ligands:
Mg2+ - 17/20
cobalamin - 2/20
TPP - 1/20
 RS: URS000232E436_1816219
MFE: -40.842
Ligand: cobalamin
Species: Colwellia sp. PAMC 21821 Cobalamin riboswitch
 RS: URS0000C488E5_1605376
MFE: -45.725
Ligand: Mg2+
Species: Clostridiales bacterium PH28_bin88 M-box riboswitch (ykoK leader)
 RS: URS0000D9D7F2_1121025
MFE: -30.831
Ligand: Mg2+
Species: Atopostipes suicloacalis DSM 15692 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120831 URS000232E436_1816219 URS0000C488E5_1605376 URS0000D9D7F2_1121025
Length 167. 168. 167. 166.
Similarity - 0.956 0.954 0.952
Ensemble Norm 0.860 - - -
MFE -46.391 -40.842 -45.725 -30.831
Ligands - cobalamin Mg2+ Mg2+
Gene YWHAB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 18.002 16.002 6.001
Length SE - 1. 0. 1.
Lev Distance - 52. 56. 62.
UBS 6. 7. 7. 4.
BS 5. 2. 7. 6.
ILL 2. 3. 1. 2.
ILR 1. 2. 2. 1.
H 2. 3. 3. 2.
BL 2. 1. 4. 2.
BR 2. 4. 4. 3.
UN 0.228 0.185 0.186 0.265

Sequences

Field Description
UTR seq + 25 uuucaucauccuucacugguuauggagccuggcaggacccaagauucccuaggaagggaauuggguuugaaucaagaaaaucuguuuguuggagccgguuacugagucaggccggauccccaggaaaaaauaucaggggggaATGACAATGGATAAAAGTGAGCTGG
UTR dot + 25 .(((((((((((((.(((((…….((((((((((((((..(((((((….)))))))))))))…………..)))……(((.(((((..(((…)))))))).))))))))…….))))))))))).)))…))))…………..
RS 1 seq ACAGUGGCUAAAUAGUUUAGUUACUGUUUUAUAUAGUAUGUUUGAGGGAAGAAGAUGAGAAUUCUUCACUGCCCCCGCAACGGUAAUUGUAGUUAUGCAUGCUGUAUUUAUAGCGAACAUAAUUAUAUCAGUCCGAGCACUCGAGCCUACUUAAUUAAACUGUGUUUU
RS 1 dot ((((((((((((…))))))))))))…….((((.((((((((((((((……..)))))).)…….((..(((….((((((((((..((((((….))))))..))))))))))…..))).)).))))))).))))……………..
RS 2 seq CAUUUGCUUCGUUAGGUGAGGCUCCUGUACGGAAACAGGUCGCUACCCGGAAACAUCGAAAGAUGCCAAUGGGUUAACAGGUAUUACCGGAUUAAGGUUCUACCUAAUGCGGCUGGGAAAUCCCCCUUACGCCGUGCAGUGCUAAAGCUCAACGAGUGGAGAGAACA
RS 2 dot ..(((((.(((((((.(..(((..((((((((….(((..((((((((….((((….))))….)))))…..)))….(((.(((.((((…))))))).)))..(((….))))))….)))))))).)))..).)).))))))))))…….
RS 3 seq AAUAUAUUUUGUUAGGUGAGGCUCCUAUAUGGAUAUAUGCUACUGCCCAAAAAUGUCGAGAGACGCCAAUGGGUGAACAGGAUAAGCCGAAAUAAGGCAAUCUUAAUGUAGCUAAAUUUAUAUUUUAACGACAUAUAGUGCUAAAACUCGACGAAUGACGGAUAAA
RS 3 dot …….((((((.(((..(((..(((((((((((((.(((((((((((….((((….))))….))))))…(((((..(((…….))).)))))…)))))……))))))…….))))))).)))…))).))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table