Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120847 Similarity: 0.975 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA120847
Gene: YWHAE
MFE: -31.297
ENS: 0.790
Length: 110.
Predicted Ligands:
TPP - 13/20
glycine - 3/20
guanidine - 2/20
RS: URS0000DA667B_302980
MFE: -34.138
Ligand: guanidine
Species: Paenibacillus sp. MY03 Guanidine-I riboswitch
RS: URS0000C7EF7A_1522368
MFE: -44.743
Ligand: TPP
Species: Modestobacter caceresii TPP riboswitch (THI element)
RS: URS0000D9B59B_553814
MFE: -34.941
Ligand: glycine
Species: Acidovorax sp. NA3 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120847 URS0000DA667B_302980 URS0000C7EF7A_1522368 URS0000D9B59B_553814
Length 110. 108. 110. 108.
Similarity - 0.975 0.973 0.972
Ensemble Norm 0.790 - - -
MFE -31.297 -34.138 -44.743 -34.941
Ligands - guanidine TPP glycine
Gene YWHAE - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 3.016 7.002
Length SE - 4. 0. 4.
Lev Distance - 28. 35. 29.
UBS 11. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 1.
ILR 2. 1. 2. 0.
H 2. 2. 2. 2.
BL 5. 5. 6. 5.
BR 6. 6. 5. 7.
UN 0.209 0.176 0.082 0.167

Sequences

Field Description
UTR seq + 25 gcugcccggacgcggagcgagaggcugagagagucggagacacuauccgcuuccauccgucgagcaggcugagcgauacgacgaaATGGATGATCGAGAGGATCTGGTGT
UTR dot + 25 ((((((.(..((((((..(.(((((.((.((.(((…))).)).)).)))))).)))).))..).)))..)))……………..((((…..))))……
RS 1 seq GCAAAGGGAUUCUAGGGUUCCGCGGCGCUCGCGCCGGACUGGUCCGAGGGAAUCCGCGCGAUAGCCGUUCUAUUGCGAAUGACACGGAGGGACAAAAGCCCGGGAGAU
RS 1 dot ((((.(((((….((.(((((((((.((((.(((…..))).)))).)…))))).)).).))))))).))))…………(((.(….))))…….
RS 2 seq AGCGGCGCACACGGGAGCCCGGGCGCGGGCUGAGAAGGCGGACGACCACCGCCGACCGUCCACACCUGAUCCGGUUCAUGCCGGCGGAGGGAGCUGCUCGAUGCUCGCAG
RS 2 dot ..(((((…((.(((…((((.(.((((.(.(..(((((…….)))))..)))))).).)))).))).))…)))))…..(.((((……..)))).)..
RS 3 seq UCGUGCCCGUCAGGAGAGAGUGCCCCGUCCCUUGCAAGAGAGGAUGCGCGGCACCGCCGAAGGCGCAGGAACACCCGAACGCUCAGGCAAAAGGACUGGCAACCGCCC
RS 3 dot ((.(((((.((.((…(.((((((((((((((….))).))))).).)))))).)))).)).))).))……….((.(((………)))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table