Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120901 Similarity: 0.977 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA120901
Gene: ZBED3
MFE: -48.759
ENS: 0.805
Length: 115.
Predicted Ligands:
TPP - 15/20
methionine - 2/20
tetrahydrofolate - 1/20
 RS: URS0000C15866_76728
MFE: -47.118
Ligand: TPP
Species: Streptomyces vitaminophilus TPP riboswitch (THI element)
 RS: URS0000C0B491_1125712
MFE: -41.244
Ligand: TPP
Species: Olsenella profusa F0195 TPP riboswitch (THI element)
 RS: URS0000DAC1F9_1904969
MFE: -48.149
Ligand: TPP
Species: Saccharomonospora sp. CUA-673 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120901 URS0000C15866_76728 URS0000C0B491_1125712 URS0000DAC1F9_1904969
Length 115. 114. 114. 115.
Similarity - 0.977 0.973 0.973
Ensemble Norm 0.805 - - -
MFE -48.759 -47.118 -41.244 -48.149
Ligands - TPP TPP TPP
Gene ZBED3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 14.002 8.001
Length SE - 1. 1. 0.
Lev Distance - 29. 29. 33.
UBS 9. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 4.
ILR 3. 3. 3. 3.
H 2. 2. 3. 3.
BL 4. 3. 1. 2.
BR 1. 1. 3. 0.
UN 0.061 0.105 0.105 0.087

Sequences

Field Description
UTR seq + 25 cgccuggagggggaucuaccaucucggacucccgacccgccgccggcuccggccgcguuucccggguaaagggcgugcgggcgccgcagaATGAGGAGTGGCGAGCCGGCCTGCA
UTR dot + 25 …..((.(((((.(((……..))))))))..)).((.((((((((..(((((.((((….((….(((((….)))))))…..)))).)))))))))))))..)).
RS 1 seq CAGGACAUCCGCGGGAGCCCGGGCGCAACCGGGCUGAGAGUGGGGCUGGGCGGCCCCUGACCGUACGAACCUGAUCCGGGUCAUGCCGGCGAAGGGAGGCAGGUUCCCCCAUGG
RS 1 dot …….(((((…(((((((……)))))))….)))))..((((.((..((((.((.(…..(((…((((……))))…)))).))))))..))))))…
RS 2 seq UUACGACCAAUGGGGAGCUCGCGAGAUGCGGGCUGAGAGGGAGCGUAUGCCCGCUCCGACCCUAUGAACCUGAUGCGGGUAAUGCCGUCGAAGGGAGUGCGUAUGUCGCAGCCA
RS 2 dot ……((….)).(((((((…..)))))))….((..((((((((.(((((((((..(((..(((((…))))).)))..)))….)))))).))))).)))..)).
RS 3 seq CAUUACCGCCACGGGAGUCCGGUGCACCGGCCGGACUGAGAGGUGGGCGCACGACCCACGACCGUUCGCACCUGAUCCGGAUCAUGCCGGCGCAGGGAGGCAGGCUCACCUCGGG
RS 3 dot …..((……))((((((((……))))))))..(((((((((((.(..((..((.(((…(((..((((….))))))))))))..))..)))..)))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table