Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120960 Similarity: 0.964 Similarity: 0.963 Similarity: 0.962
UTR: 5HSAA120960
Gene: ZBTB24
MFE: -24.852
ENS: 0.825
Length: 132.
Predicted Ligands:
cobalamin - 8/20
molybdenum - 4/20
FMN - 3/20
 RS: URS0000AB3D55_396513
MFE: -32.931
Ligand: glycine
Species: Staphylococcus carnosus subsp. carnosus TM300 Glycine riboswitch
 RS: URS0000AB4AC2_324602
MFE: -48.012
Ligand: FMN
Species: Chloroflexus aurantiacus J-10-fl FMN riboswitch (RFN element)
 RS: URS0000ABC9BB_706434
MFE: -32.723
Ligand: FMN
Species: Megasphaera micronuciformis F0359 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120960 URS0000AB3D55_396513 URS0000AB4AC2_324602 URS0000ABC9BB_706434
Length 132. 132. 133. 132.
Similarity - 0.964 0.963 0.962
Ensemble Norm 0.825 - - -
MFE -24.852 -32.931 -48.012 -32.723
Ligands - glycine FMN FMN
Gene ZBTB24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.003 18.017 13.006
Length SE - 0. 1. 0.
Lev Distance - 45. 42. 46.
UBS 8. 7. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 3.
ILR 2. 1. 4. 3.
H 3. 3. 4. 3.
BL 4. 2. 2. 4.
BR 0. 2. 1. 2.
UN 0.197 0.144 0.068 0.121

Sequences

Field Description
UTR seq + 25 uuaccaaauuaaugaaaaaauuuuugugguuaaaguacuauauuuaaagugauuauuuuucagggaagugcuuuaacacaaaucacugaagaaaaggcagggagagcATGGCAGAAACATCGCCAGAGCCTT
UTR dot + 25 ………………….(((((.(((((((((((……(((((….)))))…….))))))))))))))))…(((………))).(((.((.((((.((….))))))..)))))
RS 1 seq AUGAUCAGUAUUGGAGAGCAUAGGUUUUGACUAUUGAAAAGCAACUUGCUUUUUAAUAAAUUGUCAGAAUUUAUCGCCGAAGGGGCAAGAUAAUUGUUCGAAUCUCUCAGGCAAAAGGAUAAUACUGUGACG
RS 1 dot ……….((((.((…(((((((((((((((((((((((…))))))))))))….))))))))))))).))))..((((((…..))))))…..((.(((…………..))).))..
RS 2 seq GAAGACCUUCGGGGCAAGGUGAAAUUCCUGAUCGGCGGUAAUGGUGGCGUGCCCACACAAGCCCGCGAGCCGUAAGGCAGGACCCGGUGUGAUUCCGGGGCCGACGGUAUAGUCCGGAUGGGAGAAGGUCGGC
RS 2 dot ….(((((……)))))…..(((((.((.(((((..((..((((((….)))..)))..)).)))))..)))))))(((((…….)))))((((((…….(((…..)))….))))))
RS 3 seq GAUAGUCUUUGAGGCGAGGUGAGGAAGCUGGGCUUUCAAUUCCCGACCGGCGGUUAUAGUCCGUGAGCUCAUGCCGAGUUGAACCGGUGCAAUUCCGGUACCGACAGUACAGUCUGGAUAAAAAAGACAGUG
RS 3 dot …………(((…(((((…((.(((((…((((.((….)).))))..)))))))…))))))))..((((.(((((…….)))))..))))..(((.((((………)))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table