Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA120987 Similarity: 0.977 Similarity: 0.974 Similarity: 0.972
UTR: 5HSAA120987
Gene: ZBTB39
MFE: -29.607
ENS: 0.935
Length: 111.
Predicted Ligands:
TPP - 10/20
methionine - 5/20
GMP - 4/20
 RS: URS0000D90F2C_459858
MFE: -29.591
Ligand: TPP
Species: Mycobacterium noviomagense TPP riboswitch (THI element)
 RS: URS0000D9272C_1122192
MFE: -43.466
Ligand: TPP
Species: Marinactinospora thermotolerans DSM 45154 TPP riboswitch (THI element)
 RS: URS0000C6F5E2_36809
MFE: -44.108
Ligand: methionine
Species: Mycobacterium abscessus S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA120987 URS0000D90F2C_459858 URS0000D9272C_1122192 URS0000C6F5E2_36809
Length 111. 110. 111. 113.
Similarity - 0.977 0.974 0.972
Ensemble Norm 0.935 - - -
MFE -29.607 -29.591 -43.466 -44.108
Ligands - TPP TPP methionine
Gene ZBTB39 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 10.001 6.003
Length SE - 1. 0. 4.
Lev Distance - 26. 30. 29.
UBS 11. 10. 11. 11.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 3. 2. 3. 3.
H 2. 2. 2. 2.
BL 7. 5. 4. 5.
BR 5. 5. 5. 4.
UN 0.126 0.155 0.153 0.071

Sequences

Field Description
UTR seq + 25 gaagcggcggcggcgauggugcucggggcgccgcagagccggauuaacugugcugauaaggagguaauuucauaggagcugcuaagATGGGCATGAGGATCAAACTGCAAA
UTR dot + 25 ….((((.((((((.(.(….).)..))))))…))))((((..(((((((.((.((.((.(………..).)).))…)).))))).))))))……….
RS 1 seq CUGACGAAUCACGGGAGUCCCAGGAACGGGGUCUGAGAGUGGGCGCGCCUGCCCUUACCGUUCGACCUGAUCCGGAUGAUGCCGGCGAAGGGAGCGCAAGGAAAUGUCAC
RS 1 dot ….(.(.((.((((..((((……)))))))).)).).)((((.((((((..((.((((((……..)))))).))..)))…))).))))………….
RS 2 seq CGAGAACCCCGCGGGAGCCGGGCGGACCCGGCUGAGAGGGAGGCUGACCGCCUCCGACCGCACGAACCUGAUCCGGAUCAUGCCGGCGAAGGGAGCGGAGGGCGACAUCAU
RS 2 dot …….(((.(…(((((((….)))))))..).)))..(((..(((((((((.(((((.((.((……)).)).))).))))..))).))))..)))……..
RS 3 seq GGUCAUGAGAACCAGCGACAAGCCCUGGCUAGCUGGUCGGCAACCCUCCACCACGGUGGGGUGCUCCAGGUGACGACCGGGCCGCGCUCAACCGUGCGUGGCAAGCGUGGACU
RS 3 dot (((..((.(.((((((….(((….))).)))))))..)))))((((((((((((.((((((.((.(((….))).))..)))))).)))))).))))..))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table