Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121017 Similarity: 0.987 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA121017
Gene: ZBTB46
MFE: -10.627
ENS: 0.888
Length: 58.
Predicted Ligands:
unknown - 16/20
cobalamin - 4/20

 RS: URS0000C7E9F2_1619033
MFE: -19.219
Ligand: cobalamin
Species: Candidatus Yanofskybacteria bacterium GW2011_GWE2_40_11 Cobalamin riboswitch
 RS: URS0000DB3D74_1610493
MFE: -24.175
Ligand: cobalamin
Species: Tessaracoccus flavus Cobalamin riboswitch
 RS: URS0000C3B6C5_882083
MFE: -23.794
Ligand: cobalamin
Species: Saccharomonospora marina XMU15 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121017 URS0000C7E9F2_1619033 URS0000DB3D74_1610493 URS0000C3B6C5_882083
Length 58. 58. 59. 59.
Similarity - 0.987 0.986 0.985
Ensemble Norm 0.888 - - -
MFE -10.627 -19.219 -24.175 -23.794
Ligands - cobalamin cobalamin cobalamin
Gene ZBTB46 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.019 3.018 5.
Length SE - 0. 1. 1.
Lev Distance - 17. 17. 17.
UBS 4. 3. 4. 5.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 2. 1. 1. 1.
H 2. 2. 2. 3.
BL 0. 0. 0. 0.
BR 0. 0. 1. 1.
UN 0.086 0.224 0.220 0.068

Sequences

Field Description
UTR seq + 25 agucuguagaagaggcgacaccagggcuuccaaATGAACAACCGAAAGGAAGATATGG
UTR dot + 25 .((((…….))))….(((…(((((…((……))…)))))…)))
RS 1 seq GCUGGUGAGAAUCCAGCACUGUCGCGCAACGGUAAUCCCCUCCUUGGGGUAAGUCCGG
RS 1 dot (((((…….)))))…………(((….((((…..))))…..))).
RS 2 seq UCCGGUGCGAACCCGGAACUGACGCGCAACCGUAUCCGGCCCAUGGGCCGGGAGUCGGA
RS 2 dot (((((…….)))))…………(((..(((((((….)))))).)..))).
RS 3 seq CCCGGUGCGAAUCCGGGACGGUCCCGCCACUGUGACUGGUCUGUCGGCCAGGAGUCAGA
RS 3 dot (((((…….)))))..(((…))).((((..((((((….))))))..).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table