Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121045 Similarity: 0.992 Similarity: 0.989 Similarity: 0.988
UTR: 5HSAA121045
Gene: ZBTB8OS
MFE: -11.660
ENS: 0.996
Length: 44.
Predicted Ligands:
preQ_1 - 10/20
unknown - 6/20
SAM - 2/20
 RS: URS0000ABCB80_1002809
MFE: -7.436
Ligand: preQ_1
Species: Solibacillus silvestris StLB046 PreQ1 riboswitch
 RS: URS0000D6BD70_272623
MFE: -11.527
Ligand: unknown
Species: Lactococcus lactis subsp. lactis Il1403 DUF1646 RNA
 RS: URS0000E60786_1140003
MFE: -13.577
Ligand: unknown
Species: Enterococcus sulfureus ATCC 49903 DUF1646 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121045 URS0000ABCB80_1002809 URS0000D6BD70_272623 URS0000E60786_1140003
Length 44. 45. 44. 45.
Similarity - 0.992 0.989 0.988
Ensemble Norm 0.996 - - -
MFE -11.660 -7.436 -11.527 -13.577
Ligands - preQ_1 unknown unknown
Gene ZBTB8OS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.004 4.002 4.004
Length SE - 1. 0. 1.
Lev Distance - 9. 14. 14.
UBS 4. 4. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 2. 1. 1. 1.
H 2. 2. 2. 2.
BL 1. 1. 0. 0.
BR 0. 0. 0. 0.
UN 0.023 0.089 0.068 0.089

Sequences

Field Description
UTR seq + 25 ccgggccgaaguccgguggATGTTTCAATCTTGGTTACACGCAT
UTR dot + 25 ((((((….))))))((..(((.(((….)))..)))..)).
RS 1 seq CUUUGCGUGGUUCGUAACCAUCCCACGUUAAAAAACUAGGAGGAA
RS 1 dot ..(((((…..)))))((.(((…(((….)))..)))))..
RS 2 seq GGUUGGGCGCAAGCUUCAAGACAUAUCUCCAAGGGUGAGGAGAU
RS 2 dot .(((((((….))))…)))..((((((……..))))))
RS 3 seq GGUUGAGCGUAAGCUUCAAGACAUAGUUCCCAAGGGUGAGGGAAC
RS 3 dot .(((((((….))))…)))…((((((……..))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table