Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121104 Similarity: 0.981 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA121104
Gene: ZC3H13
MFE: -25.837
ENS: 0.805
Length: 88.
Predicted Ligands:
glycine - 7/20
guanidine - 6/20
TPP - 2/20
 RS: URS000232A574_546414
MFE: -26.465
Ligand: zmp-ztp
Species: Deinococcus deserti VCD115 ZMP/ZTP riboswitch
 RS: URS00021EDB58_12908
MFE: -22.723
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS0000D8FDE0_1797494
MFE: -30.997
Ligand: homocysteine
Species: Betaproteobacteria bacterium RIFCSPLOWO2_12_61_14 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121104 URS000232A574_546414 URS00021EDB58_12908 URS0000D8FDE0_1797494
Length 88. 88. 87. 88.
Similarity - 0.981 0.981 0.980
Ensemble Norm 0.805 - - -
MFE -25.837 -26.465 -22.723 -30.997
Ligands - zmp-ztp guanidine homocysteine
Gene ZC3H13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 6. 5.006
Length SE - 0. 1. 0.
Lev Distance - 24. 23. 25.
UBS 6. 7. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 3. 3. 1. 2.
H 2. 2. 2. 3.
BL 1. 2. 1. 0.
BR 1. 2. 1. 0.
UN 0.080 0.091 0.092 0.159

Sequences

Field Description
UTR seq + 25 aacagggcaaaccucugacuuccggcggcauuuugaggcgguccuccuagcggccuguacaaaATGTCAAAAATTAGAAGGAAGGTCA
UTR dot + 25 ..(((((…..))))).(((((..((((((((((((((.((…….)).))))…)))))))))……..)..)))))….
RS 1 seq UGAGCGGGGGACAACUGGCGCUGAUCGUGGGGCAACCACGGGGGAGUCACCCGAACUUCAAAUUGGAUCGCGCGCCUGGGUCGGAGGG
RS 1 dot …((.((……)).)).((((((..((.((..(((((((…….))))……….)))…..)).))..))))))….
RS 2 seq ACCCCUUUGCCGCCGGGUAAAGCAACUAAGCACUAAGCUUCAUAUCGUUAGGCCUUAGAAGAUAUGGAGAACUGGCGUUUUUGUGGA
RS 2 dot ….(((((((….)))))))(((..((((.(((..(((((((((…………..)))))))))…))).)))))))….
RS 3 seq CCCUCCGAGGGGUGCUGCAGCGGGUCUGGACAACCAGUCCCCCGUCAGGCUCGGAGCAGCGAUUUCGUUCCAACGGCACCUGUUCAUU
RS 3 dot ((((….))))((((((..(((((((((((…..))))……)))))))..))))))……….(((((…)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table