Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121170 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA121170
Gene: ZC3H7A
MFE: -8.867
ENS: 0.995
Length: 68.
Predicted Ligands:
fluoride - 18/20
SAM - 2/20

 RS: URS0000AB9BCA_439493
MFE: -6.902
Ligand: SAM
Species: Candidatus Pelagibacter sp. HTCC7211 SAM-V riboswitch
 RS: URS0000C41564_1492898
MFE: -12.723
Ligand: fluoride
Species: Flavisolibacter sp. LCS9 Fluoride riboswitch
 RS: URS0000DB4593_1255690
MFE: -7.163
Ligand: fluoride
Species: Sphingobacterium faecium PCAi_F2.5 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121170 URS0000AB9BCA_439493 URS0000C41564_1492898 URS0000DB4593_1255690
Length 68. 67. 68. 68.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.995 - - -
MFE -8.867 -6.902 -12.723 -7.163
Ligands - SAM fluoride fluoride
Gene ZC3H7A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 3.005 4.003
Length SE - 1. 0. 0.
Lev Distance - 18. 19. 19.
UBS 5. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 0. 0. 1. 2.
BR 2. 1. 1. 2.
UN 0.191 0.239 0.265 0.250

Sequences

Field Description
UTR seq + 25 aaaacgaaucuuuuaauuguuuaagguacuugguaaucaaauaATGTCCAATGTGTCCGAGGAGAGAA
UTR dot + 25 .((((((………))))))..(((((((((..((……))..)))).))).))……….
RS 1 seq AUAAUCGGUAGGCAUUUGAACUGUAUUGUGCGCCUAACAUAAAGUUAAAGCACUAAAAAAGGAGUAA
RS 1 dot ..(((((((……….)))).)))((((…((((…..))))..))))…………..
RS 2 seq CUAUAUACAGGAAAUGGUGUCUUCCUGCCCCAACCGCUUCUUCUAAAGCUAAUGGCGCCUACAAGUAG
RS 2 dot …….((((((……..))))))(.(((…((((……))))…))).)………..
RS 3 seq AAACAAAAAGGAAAUGGUGUUCUUCCUUAACCAACCGCCCUCAAAAAGCUGAUGACGCCUGAUUAAAA
RS 3 dot …….((((((………))))))…((..((.(.(((……))).).))..))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table