Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121275 Similarity: 0.957 Similarity: 0.956 Similarity: 0.955
UTR: 5HSAA121275
Gene: ZCCHC9
MFE: -58.
ENS: 0.871
Length: 158.
Predicted Ligands:
TPP - 11/20
cobalamin - 6/20
glucosamine - 2/20
RS: URS0002331FC4_56956
MFE: -73.147
Ligand: cobalamin
Species: Thermus brockianus Cobalamin riboswitch
RS: URS0000C112A1_67257
MFE: -65.753
Ligand: TPP
Species: Streptomyces albus subsp. albus TPP riboswitch (THI element)
RS: URS0000C805D8_1906
MFE: -70.561
Ligand: TPP
Species: Streptomyces fradiae TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121275 URS0002331FC4_56956 URS0000C112A1_67257 URS0000C805D8_1906
Length 158. 159. 159. 157.
Similarity - 0.957 0.956 0.955
Ensemble Norm 0.871 - - -
MFE -58. -73.147 -65.753 -70.561
Ligands - cobalamin TPP TPP
Gene ZCCHC9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.006 7.003 6.
Length SE - 1. 1. 1.
Lev Distance - 51. 55. 56.
UBS 12. 10. 11. 12.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 4.
ILR 4. 2. 2. 2.
H 5. 5. 5. 6.
BL 2. 1. 1. 1.
BR 3. 3. 3. 3.
UN 0.057 0.132 0.113 0.057

Sequences

Field Description
UTR seq + 25 gggcacuaugugcuuccggucuccaauaccgcaggagggcggucuuccccggcucgccaacucggcugcucugggggauucgugcgcgguaagaagcugcgcgguagcgcggugagguaccacugaugaaauuATGACCAGGTGGGCCCGAGTTAGTA
UTR dot + 25 ((((((…))))))(((.(((((………))))).)))..((((((((..((((…..))).)..))))))))(((((..(.((((….(((((((….)))))))….)))).)..)))))….((((..((…..))..))))…
RS 1 seq AGCCAGGUCCGUUGCCCUGGUGCCUGGGCGCGUAGUCCAGGCUUAAAGUGGGGAAGUCCGGUGCAAGUCCGGCGCUGUCCCGCAACGGUAACCGGCCAAGCUACGCGGUUCGCUUCGCAGGCCGGAAGCCCGAAUACCUGCCAGGGCCGCCCGCCUUGC
RS 1 dot .((((((……..))))))((((((((…..))))))))…..((((((.(((((((…….)))).))).))))))…(((..((((((..((…(((…)))…)).))))))..)))………..((((((…..)))))).
RS 2 seq CUUUGCAAUCGCGGGAGCUCGGAGCACCGGGCUGAGAGGACGCUGAACUCCGUACGGAGCGGCCGGUGGACCGGCACUCCGAGGGUACGGAAACCGCUGCGUCGACCGCUGAACCUGUUACCGGGUAAUGCCGGCGUAGGGAGUGGGUCUGAUGACCUC
RS 2 dot .(((((….)))))(((((((….)))))))……………(((((((((((..(((((….))))).))))….))))))).(((.((((((((…((…(((((….)))))…)))))))))).).))(((((….))))).
RS 3 seq CUUUGCACACGCGGGAGCUCGGAGCACCGGGCUGAGAGGGCGCUGACCUCCGUACACGGGGUGGCCGGGACCGGCCGUACCGUCGCGGAAGCCGCUGCGCCGACCGCCGAACCUGGUACCGGGUAAUGCCGGCGUAGGGAGUAGGUCUCAUGACCGU
RS 3 dot .(((((….)))))(((((((….)))))))..((((…….))))(((..((((..((((((….))))))..)))).)))…(((.((((((((…((…(((((….)))))…)))))))))).).)).((((….))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table