Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121277 Similarity: 0.971 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA121277
Gene: ZCCHC9_0
MFE: -47.473
ENS: 0.876
Length: 130.
Predicted Ligands:
cobalamin - 6/20
SAM - 5/20
TPP - 4/20
 RS: URS0002323292_83332
MFE: -55.
Ligand: glycine
Species: Mycobacterium tuberculosis H37Rv Glycine riboswitch
 RS: URS0000AB5DE6_12908
MFE: -23.537
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000D78BD8_1312072
MFE: -26.802
Ligand: SAM
Species: Polaribacter sp. SA4-12 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121277 URS0002323292_83332 URS0000AB5DE6_12908 URS0000D78BD8_1312072
Length 130. 131. 129. 129.
Similarity - 0.971 0.970 0.969
Ensemble Norm 0.876 - - -
MFE -47.473 -55. -23.537 -26.802
Ligands - glycine cobalamin SAM
Gene ZCCHC9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3.006 14.
Length SE - 1. 1. 1.
Lev Distance - 35. 38. 34.
UBS 9. 8. 8. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 2. 3. 1. 4.
H 4. 4. 4. 4.
BL 2. 2. 2. 4.
BR 3. 1. 2. 1.
UN 0.092 0.092 0.171 0.093

Sequences

Field Description
UTR seq + 25 gggcacuaugugcuuccggucuccaauaccgcaggagggcggucuuccccggcucgccaacucggcugcucugggggauucgugcgcgguaccacugaugaaauuATGACCAGGTGGGCCCGAGTTAGTA
UTR dot + 25 ((((((…))))))(((.(((((………))))).)))..((((((((..((((…..))).)..))))))))…..((.(((..(((((…………….)))))..))).))…..
RS 1 seq UGCCUCUGGAAAGCGGUGGCGACCCCUGGCGGUCCUCACCCGCCGAUGGGGAAAGGCGAUUCACCUGACGGUGGACAGAGUCGCCGAAUCUCUCAGGCGCCUGGCGUGCAGGUGAAGACAGAGGGAGAGGG
RS 1 dot ((((.(((…..))).)))).((((((((((…….))))))..))))…((((((((.((…….))…))))))))…((((((…((((((…..))))))……))))))…..
RS 2 seq AUAUCGAAUCUUGAUGGGGAAUAAUGUGCAAAUCAUUAGCUGUUCCUGCAACGGUAAAAGACCGAGUGCCAUCCGAUACAGACCGUUGUCGAAUGAAGGCCAGGAAAAGUCUAGUUCUACAAUUUAAAA
RS 2 dot .((((((…))))))(((((((….((………)))))))))(((.((((…..))))..)))……………(((((.((((..((((……..)))).)))).)))))……
RS 3 seq CCGUUAUCACGAAAGGUAGAGGGAUUAGACCCGCUGAAGCCUUAGCAACCCAUUUCGUUAAGAAAUAAAGGUGCUACAUUCUACAGAUUAUCUUGAACAAGUUUCAUUAAUUAAUCUGACAGAUAACAG
RS 3 dot .(((….)))..((((((.(((……))).))…))))((((.(((.(((((…..)))))…)))))))…(((.(((((((…((((…..))))…..)))))))..)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table