Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121384 Similarity: 0.971 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA121384
Gene: ZDHHC20
MFE: -24.779
ENS: 0.862
Length: 121.
Predicted Ligands:
methionine - 5/20
cobalamin - 4/20
TPP - 3/20
 RS: URS0000DA4245_1920636
MFE: -48.759
Ligand: Mn2+
Species: Ochrobactrum sp. P6BS-III yybP-ykoY manganese riboswitch
 RS: URS0001E88DDE_2055160
MFE: -48.478
Ligand: TPP
Species: Kyrpidia spormannii TPP
 RS: URS000232DA36_1268239
MFE: -25.485
Ligand: cobalamin
Species: Pseudoalteromonas luteoviolacea B = ATCC 29581 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121384 URS0000DA4245_1920636 URS0001E88DDE_2055160 URS000232DA36_1268239
Length 121. 121. 122. 120.
Similarity - 0.971 0.970 0.969
Ensemble Norm 0.862 - - -
MFE -24.779 -48.759 -48.478 -25.485
Ligands - Mn2+ TPP cobalamin
Gene ZDHHC20 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 7.001 7.004
Length SE - 0. 1. 1.
Lev Distance - 38. 36. 38.
UBS 9. 9. 10. 8.
BS 0. 0. 0. 0.
ILL 0. 1. 2. 1.
ILR 1. 1. 0. 2.
H 4. 4. 4. 4.
BL 3. 2. 4. 3.
BR 3. 2. 3. 1.
UN 0.050 0.050 0.082 0.117

Sequences

Field Description
UTR seq + 25 cgguaguguuuuguaaaaaaguuaaaauccaccugcaaucugcagccauauaucugccagaaucauuccgcgcacccacguuuucauacggaccugATGGCGCCCTGGACGCTGTGGCGCT
UTR dot + 25 .(((.(.((((((………)))))).))))…..(((((((……..)))).)))((((.((((………………))))..))))(((((((……..).))))))
RS 1 seq AUAAGCCGCAUCGGGGAGUAGCCACCACCGAAGCGCGGCCCAUUAUGGCGGCGCUGAGAUCAAGUGGGAUCACGUCAACACAAUCGCUGAAAAGCGUGGCGUGAUCAGCCGUUCAACGGCC
RS 1 dot ….(((((.((((((……..)).))))…)))))(((((.((((……..).))))))))((((((((((…….((((….)))))))))))))).(((((…))))).
RS 2 seq AUGUUCCGCGGGGGGUGCCGUGCCGCCGGGAGGAGGCGAGCACGGCUGAGAGAGGCCGGCAGCCUUAACCCUUGGAACCUGUCUGGGUCAUGCCAGCGAAGGGACGGUGGAACAAGAUCGAC
RS 2 dot ….(((.(((.((……..)).)))))).(((((..((.(((((……))))))).)))))..(((((.(…….((((……))))).))))).((((……..))))..
RS 3 seq UAAUGUCGGCGCAAUUAUCAUUUUGGCAGAUAUUGGGAAGAAGGUGUAAGUCCUUCACUGUCCCCGCAACUGUAAAUGCAAACGCAUAAGUCAGAUACCAAGGCUAAAAUGAGAGUUUGA
RS 3 dot .((((((.((.(((……..))))).))))))((((.(((((…….)))))….))))…..(((…((((….))))….)))……(((((……..)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table