Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121443 Similarity: 0.984 Similarity: 0.983 Similarity: 0.981
UTR: 5HSAA121443
Gene: ZDHHC6
MFE: -21.817
ENS: 0.708
Length: 87.
Predicted Ligands:
SAM - 7/20
TPP - 5/20
glycine - 3/20
 RS: URS0000AB358D_908337
MFE: -17.849
Ligand: TPP
Species: Eremococcus coleocola ACS-139-V-Col8 TPP riboswitch (THI element)
 RS: URS0000C34999_1144318
MFE: -24.355
Ligand: glycine
Species: Polaromonas sp. CF318 Glycine riboswitch
 RS: URS0000C5A6A1_316274
MFE: -28.211
Ligand: zmp-ztp
Species: Herpetosiphon aurantiacus DSM 785 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121443 URS0000AB358D_908337 URS0000C34999_1144318 URS0000C5A6A1_316274
Length 87. 87. 88. 86.
Similarity - 0.984 0.983 0.981
Ensemble Norm 0.708 - - -
MFE -21.817 -17.849 -24.355 -28.211
Ligands - TPP glycine zmp-ztp
Gene ZDHHC6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 4. 12.005
Length SE - 0. 1. 1.
Lev Distance - 20. 20. 21.
UBS 5. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 2.
ILR 0. 2. 1. 0.
H 3. 3. 3. 3.
BL 2. 2. 2. 2.
BR 1. 1. 0. 3.
UN 0.207 0.230 0.227 0.140

Sequences

Field Description
UTR seq + 25 uugugcgugugcuauuguugcugcgauagcucuccuuuggguggaacacagugaagaucgacATGGGTACATTCTGTTCGGTTATCA
UTR dot + 25 ……….((((((((….))))))))..(((…….)))……(((.((((((.(((((…..))))))))))).)))
RS 1 seq UAAUAACAUUUGGGGUGCGUUUGCUGAGAUUAUACCCAUGGAACCUGUCCAGAUAAUGCUGGCGUAGGAAAAUGUUCUAAGAAGGCU
RS 1 dot …………(((((.((((….))))..))))).((((…..))))……(((..(.(((((…..))))).)..))).
RS 2 seq GUCAGGAGAGAGUUUUCCCCGGGAAAACCGCCGAAGGCGCACGUACACCCCCUUUUGGUGCACUGAACGCUCAGGCAAAAGGACUGGC
RS 2 dot ………..(((((((…)))))))((((…))))……..((.(((((…(((.((((….))))))))))))…)).
RS 3 seq GCAUGAAUCGGUGACUGGCGAUACACAAACGUGGGCAACCACGGGGGAGCCGAUUUGCGCAGAUGCCGCUCGCCUGGGCAAAGGGC
RS 3 dot …((.((((……..)))).))….(((((….)))))…..(((..(((((.(((..((…..))))).))))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table