Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121600 Similarity: 0.947 Similarity: 0.946 Similarity: 0.944
UTR: 5HSAA121600
Gene: ZFAND6
MFE: -24.041
ENS: 0.926
Length: 167.
Predicted Ligands:
FMN - 5/20
cobalamin - 4/20
Mg2+ - 4/20
 RS: URS0000C4E3EA_669041
MFE: -37.496
Ligand: SAM
Species: Tenacibaculum sp. 35/09 SAM riboswitch (S box leader)
 RS: URS00023264BE_1122189
MFE: -51.108
Ligand: cobalamin
Species: Malonomonas rubra DSM 5091 Cobalamin riboswitch
 RS: URS00023174C1_1801701
MFE: -53.404
Ligand: cobalamin
Species: Nitrospirae bacterium GWD2_57_9 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121600 URS0000C4E3EA_669041 URS00023264BE_1122189 URS00023174C1_1801701
Length 167. 168. 166. 168.
Similarity - 0.947 0.946 0.944
Ensemble Norm 0.926 - - -
MFE -24.041 -37.496 -51.108 -53.404
Ligands - SAM cobalamin cobalamin
Gene ZFAND6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 24. 21.003 7.003
Length SE - 1. 1. 1.
Lev Distance - 61. 64. 71.
UBS 7. 9. 10. 9.
BS 3. 0. 4. 3.
ILL 4. 1. 4. 3.
ILR 2. 2. 5. 2.
H 3. 4. 3. 3.
BL 3. 2. 4. 2.
BR 1. 1. 0. 2.
UN 0.114 0.125 0.169 0.167

Sequences

Field Description
UTR seq + 25 acagcuucaagugaaguuaaucugaggugaagcaaacagaaaauuguggagguuuuguugguggagauaaguaauuaacauuucgaaacaggaaaugaaaggauuuauauuuuuaaaagcuauaggugugcaacugaggaacATGGCTCAAGAAACTAATCACAGCC
UTR dot + 25 …((((((..(..((…..))..).))))))……….((((((.((((((.(((.((((((((………((((((…….))))))……….))))))))..((((….((((………..)))))))))))))))))..))))))..
RS 1 seq AUGUUAUCAAGAAAGGUGGAGGGAUUAGACCCAAAGAAACCUUAGCAACCCUUUAUUUGGAAAGUUUAAAAAUUUUAGAAUUUUUAAAUAAAUCAAAUAAAGAAGGUGCUAAAUUCUACUUAAAAACUGUUUUAUUACAAAAUUAUAGUUUUUUAAGAGAGAUAACGG
RS 1 dot …(((((……))))).(((……)))………(((((.(((((((((((((…(((((((((((….)))))))))))…))))))))))..)))))))).((((.((((((((((((…………..))))))))).)))))))…….
RS 2 seq GACAAUUGAGCUUAGUCCGGCCAAGGGAAGAGGGGUGAAAAUCCCCCGCGGACCCGCCGCUGUAAGCGAGGACAAUGGGCGACGAUGCCACUGACAACAACUGUCGGGAAGGCAGCCCAGAGGAUGAAUCGCGAGCCAGAAGACCUGCCGGACAAACAAAGCCACA
RS 2 dot ……((.((((.(((((((..(((…..((((.((…))))))((((…..)))).((..(((((..(..(((((…..((((.((((((…..))))))…)))))))))..)..)…))))..))…….))))))))))…..))))))..
RS 3 seq UUGAAUCGACCACAUCCAGGCUAAGGGAAUCCCGUUAAAAUCGGGAGCGGACCCGCCGCUGUGAUCCUGUAGUUAAUCUCUGCCGAAGCAAGCCACUGACCUGAACAGGGUCGGGAAGGCGGACAGAGAGGGGAGAGCCAGAAGACCUGCUUGGAUGUUCUCGCACAG
RS 3 dot ……(((..((((((((((..(((….((((…….))))(((((…..)))))((..((((.(…….(((((((…….(((.(((((((…..)))))))…))))).)))))).))))..))…….)))))))))))))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table