Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121692 Similarity: 0.958 Similarity: 0.957 Similarity: 0.952
UTR: 5HSAA121692
Gene: ZFPL1
MFE: -65.603
ENS: 0.867
Length: 153.
Predicted Ligands:
cobalamin - 8/20
FMN - 7/20
Mg2+ - 2/20
 RS: URS000231F060_1470557
MFE: -45.979
Ligand: cobalamin
Species: Streptomyces sp. Tu 6176 Cobalamin riboswitch
 RS: URS00023322DB_645465
MFE: -54.803
Ligand: cobalamin
Species: Streptomyces sp. e14 Cobalamin riboswitch
 RS: URS000035B29B_224308
MFE: -38.977
Ligand: Mg2+
Species: Bacillus subtilis subsp. subtilis str. 168 magnesium riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121692 URS000231F060_1470557 URS00023322DB_645465 URS000035B29B_224308
Length 153. 154. 154. 154.
Similarity - 0.958 0.957 0.952
Ensemble Norm 0.867 - - -
MFE -65.603 -45.979 -54.803 -38.977
Ligands - cobalamin cobalamin Mg2+
Gene ZFPL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.005 11. 10.005
Length SE - 1. 1. 1.
Lev Distance - 53. 53. 60.
UBS 6. 7. 7. 4.
BS 7. 7. 7. 8.
ILL 1. 2. 3. 2.
ILR 1. 1. 1. 2.
H 3. 2. 2. 2.
BL 6. 5. 4. 5.
BR 4. 6. 5. 3.
UN 0.105 0.175 0.117 0.175

Sequences

Field Description
UTR seq + 25 gauaaucggggcggccggggcugaagggagaggcgcaggagcccuggggagaguggucccugcccuuccgcgccucgagccaucgcuaccgcccuucggaaccagugcagcggccgaucagaucgaucATGGGGCTTTGTAAGTGCCCCAAGA
UTR dot + 25 (((.(((((.((.(((((..((((((((.(((((((.((((….(((((……)))))….))))))))))).(((….)))….))))))))..)).).)).))..)))))…)))..((.((((((………)))))).))
RS 1 seq CACCCGGCACAAGAUGUAUGCUCAUCCUCGCUGUCGUCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACUCGUACGCACAUGCCCUUAUGGCCGCAUACGAGCGUCAGUCCGAGGACCUGCCGACAGUGCGCCCGGCCG
RS 1 dot ..((.(((.((…(((..((…(((((((((((((.((.((((..(((((…….)))))….)))))).))))….((((((.((….(((…..))).)).))))))…)))..))))))…))..))).)).))).))…
RS 2 seq CACCCGGCACAAGAUGUAUGCUCGUCCUCGCUGUCGUCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACUCGUACACGUAUGCCCUUAUGGCCGUGUACGUGCGUCAGUCCGAGGACCUGCCGACAGUGCGCCCGGCCG
RS 2 dot ..((.(((.((…(((..((..((((((((((((((.((.((((..(((((…….)))))….)))))).))))(((((..(((((((…(((…..))))))))))))))).)))..)))))))..))..))).)).))).))…
RS 3 seq CUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAAUCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGGAUGCUUGUCCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAG
RS 3 dot ..((((.((.(..(((..((((((((.((((.((.((((((((….((((….))))….)))).((..((((((((((…….))))))))))..))))))…..)).))))…..)))))))).)))..).))..))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table