Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121705 Similarity: 0.988 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA121705
Gene: ZFPM2
MFE: -19.247
ENS: 0.725
Length: 48.
Predicted Ligands:
preQ_1 - 12/20
glutamine - 5/20
Ni/Co - 2/20
 RS: URS0000BC4686_32630
MFE: -11.263
Ligand: unknown
Species: riboswitch (47-MER) from synthetic construct (PDB 5KH8, chain A)
 RS: URS0000C6D8FD_408170
MFE: -13.609
Ligand: Ni/Co
Species: human gut metagenome NiCo riboswitch
 RS: URS0000C2DFB2_12908
MFE: -6.967
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121705 URS0000BC4686_32630 URS0000C6D8FD_408170 URS0000C2DFB2_12908
Length 48. 47. 46. 48.
Similarity - 0.988 0.988 0.988
Ensemble Norm 0.725 - - -
MFE -19.247 -11.263 -13.609 -6.967
Ligands - unknown Ni/Co glutamine
Gene ZFPM2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.005 2.009 3.011
Length SE - 1. 4. 0.
Lev Distance - 15. 12. 16.
UBS 2. 2. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 0. 1.
BR 0. 0. 0. 1.
UN 0.333 0.404 0.239 0.438

Sequences

Field Description
UTR seq + 25 cagcggcagcagccgccgccgagATGTCCCGGCGAAAGCAAAGCAAAC
UTR dot + 25 ..(((((….)))))(((((……..)))))…………..
RS 1 seq GGCGAUGGUGUUCGCCAUAAACGCUCUUCGGAGCUAAUGACACCUAC
RS 1 dot (((((……)))))……(((……)))………….
RS 2 seq GGCCCAUCGGGCAGCAGAUUCGUAAACAAACAUCUGCGGGACAGUA
RS 2 dot .((((…)))).((((((..((……))))))))………
RS 3 seq AUCGUUGGACUAAAAGUCGGAAGUAAGCAAUCGCUGAAGCAACGCACU
RS 3 dot ….((.((((…)))).))….(((….)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table