Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121708 Similarity: 0.984 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA121708
Gene: ZFR2
MFE: -9.935
ENS: 0.972
Length: 37.
Predicted Ligands:
SAM - 10/20
preQ_1 - 6/20
unknown - 1/20
 RS: URS0000D87AB1_1686310
MFE: -13.459
Ligand: SAM
Species: Bartonella apis SAM riboswitch (alpha-proteobacteria)
 RS: URS0001A24B6D_1907202
MFE: -12.438
Ligand: unknown
Species: Chains: A,B,C,D,E,F,G,H,I,J,K,L from Roseobacter sp. (PDB 6YL5, chain G)
 RS: URS0000D92E6B_1802287
MFE: -9.182
Ligand: fluoride
Species: Syntrophobacterales bacterium GWC2_56_13 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121708 URS0000D87AB1_1686310 URS0001A24B6D_1907202 URS0000D92E6B_1802287
Length 37. 36. 35. 38.
Similarity - 0.984 0.982 0.982
Ensemble Norm 0.972 - - -
MFE -9.935 -13.459 -12.438 -9.182
Ligands - SAM unknown fluoride
Gene ZFR2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.026 3.002 4.027
Length SE - 1. 4. 1.
Lev Distance - 20. 19. 22.
UBS 2. 2. 2. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 0.
ILR 0. 1. 1. 1.
H 2. 1. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 1.
UN 0.216 0.056 0.257 0.053

Sequences

Field Description
UTR seq + 25 gaagacgccaagATGGCGACGAGTCAGTATTTCGACT
UTR dot + 25 …..(((((…)))))…((((……..))))
RS 1 seq CGUGGUGAUUUGGGCCGGCCGGCUUGCAGCCACGCU
RS 1 dot ((((((…..(((((….)))))…))))))..
RS 2 seq GGUCACAACGGCUUCCUGGCGUGACCAUUGGAGCA
RS 2 dot ((((((..(((….)))..))))))………
RS 3 seq GGGGUUCACCGCAACCGCCGCUCGGCUGAUAACUCCUA
RS 3 dot (((((((((((………..))).)))..)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table