Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121733 Similarity: 0.942 Similarity: 0.941 Similarity: 0.940
UTR: 5HSAA121733
Gene: ZFYVE16
MFE: -38.972
ENS: 0.891
Length: 203.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS00023142E7_1797322
MFE: -60.315
Ligand: cobalamin
Species: Bacteroidetes bacterium GWB2_41_8 Cobalamin riboswitch
 RS: URS000231FA61_1497613
MFE: -80.716
Ligand: cobalamin
Species: Bradyrhizobium sp. BR 10245 Cobalamin riboswitch
 RS: URS000231721A_46506
MFE: -62.167
Ligand: cobalamin
Species: Bacteroides stercoris Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121733 URS00023142E7_1797322 URS000231FA61_1497613 URS000231721A_46506
Length 203. 203. 203. 204.
Similarity - 0.942 0.941 0.940
Ensemble Norm 0.891 - - -
MFE -38.972 -60.315 -80.716 -62.167
Ligands - cobalamin cobalamin cobalamin
Gene ZFYVE16 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17.003 4.002 20.007
Length SE - 0. 0. 1.
Lev Distance - 68. 77. 67.
UBS 16. 13. 15. 13.
BS 0. 0. 0. 0.
ILL 5. 6. 4. 6.
ILR 4. 3. 4. 5.
H 6. 5. 6. 5.
BL 4. 2. 3. 2.
BR 4. 3. 3. 2.
UN 0.148 0.089 0.108 0.064

Sequences

Field Description
UTR seq + 25 agguuagcgaaggguaaaggaagucagacacugacgcgaguggccucccgaucccgcagucgaguggagaaccgagucccgaccuaaggucgaaucaucaggcguccccgucacccaacaacccacucaggcacuuccggcauacaagaauuaaauucugaauaagucugcagguaggATGGACAGTTATTTTAAAGCAGCTG
UTR dot + 25 ……(((..((((…(((.((((..(.(….).)..)))).)))..)))))))……..(((……..)))(((((…)))))……..((((….))))……((.((.((((((((..(((………(((((…))))))))…)))))..))).)).))..(((((……….)))))
RS 1 seq ACUUUUGCCUCCGGAAAUGGUUCCAACGUUGGUUUACGCCAACACGGACUAAUAGGGAAUCCGGUGAAAAACCGGAGCUGUACCCGCAGCUGUAAGCCUUAAUACAAACUUUUUGAAACUCCUGCCACUGUCUCGGUUAACCGGGAUGGGAAGGCUUCAAAAAGAAGGUGAGCCAGAAGACCUGCCAAUUCCACGCACGUUAA
RS 1 dot ………(((…..((((((….((((((….))))))..))))))….)))..(((((…..)))))((((((….))))))((..(((((……..(((((((((…(((..(.(((((((((….)))))))))).))).))))))))))))))..))…..(((.(((………))).)))..
RS 2 seq AUAAUCGAAAGCCGUCGAGGUUCUCCGGAUCCCGCUUGAUCCGGAGCUAAGAGGGAAGCCGGUGCGAUGCCGGCGCUGCCCCCGCAACUGUAAGCGGCGAGCCGCUGUCCAACUCAGGUCACUGAAGCCCAUACAGCUUCGGGAAGGCCGGACAGCGACAUUGACCCGCGAGCCAGGAGACCUGCCCCGACGAAAUAUUCGUC
RS 2 dot ………..((.((..((..(((((((((……)))))))))))..)).))..((((((…..))))))..(((….)))…((..((((((((.((((((((……((((.(((((((…….)))))))…)))))))))))).).)))..))))..))((((…))))….((((((…))))))
RS 3 seq AUCUUUACCCCCGGAAUUGGCAAUCGGGAAGGCAUAUCCGCCUGCCGAUGCAAGGGAAUCCGGUGCAAAACCGGAGCUGUACCUGCAGCUGUAAUCCUCAAUAAAAGAUGUUUGUAUCCGCAAAAGCCACUGUCGCGGCAACGCGAUGGGAAGGUAAUACAAGCAGAGGAGAGCCAGAAUACCUACCAACUUCCGUAACUUGAG
RS 3 dot ……..(((..(.(((((((..((((……..))))..))))))).)..)))…(((((…..)))))((((((….))))))((..(((((………(((((((((……..(((.((((((((….))))))))…))).))))))))))))))..))(((..(((…………)))..)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table