Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121852 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA121852
Gene: ZMAT4
MFE: -18.888
ENS: 0.843
Length: 91.
Predicted Ligands:
TPP - 11/20
glycine - 6/20
fluoride - 2/20
 RS: URS0000C2E8D8_1423747
MFE: -15.573
Ligand: TPP
Species: Lactobacillus fuchuensis DSM 14340 = JCM 11249 TPP riboswitch (THI element)
 RS: URS0000BFB20F_658088
MFE: -22.272
Ligand: fluoride
Species: Lachnospiraceae bacterium 9_1_43BFAA Fluoride riboswitch
 RS: URS0000C9BD3C_1599
MFE: -17.038
Ligand: TPP
Species: Lactobacillus sakei TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121852 URS0000C2E8D8_1423747 URS0000BFB20F_658088 URS0000C9BD3C_1599
Length 91. 90. 91. 90.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.843 - - -
MFE -18.888 -15.573 -22.272 -17.038
Ligands - TPP fluoride TPP
Gene ZMAT4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.008 9.008 2.
Length SE - 1. 0. 1.
Lev Distance - 25. 25. 27.
UBS 8. 7. 6. 8.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 3. 3. 3. 3.
BL 3. 3. 2. 4.
BR 4. 4. 2. 5.
UN 0.220 0.311 0.308 0.222

Sequences

Field Description
UTR seq + 25 agaacgucuaccaagaaagcuugaggagagaagaaaagugagccgggaaaccuacuggcugcgaagATGAAGTCCTCCGATATTGATCAGG
UTR dot + 25 ……(((.(((((….)))).).)))……..((.((((((……..))))))))…(((.(((((….))).)).)))…
RS 1 seq AUAACACAUCUGGGGUGCCUACAAGCUGAGAUUAUACCCAUUGAACCUGAUAUAGUUAGUACUAGCGCAGGGAAAUGCCGUGUCGUUUAA
RS 1 dot …….((((.((.(…….).)).))))…………..(((((…)))))….((((((.((…..)).)).))))…
RS 2 seq CUUUAGCAAGGGAAUGAAGUUCUCCCUUAGUAAUACUAAAACCGCCAGGUGGAGCGUGCCUCCCCUGAUUGCUGAUGACUUCUGCUUUUUG
RS 2 dot …..((((((((………)))))).))…………..((((.((((…..))))))))…((.((…..)).))……
RS 3 seq AUAACGCAUCUGGGGUGCCUAAGAGCUGAGAUUAUACCCAUUGAACCUGAUAUAGUUAGGACUAGCGCAGGGAAAUGUCGUGUCGUUUGU
RS 3 dot …….((((.((.(…….).)).))))………….((((((…))))))((.((((((.((…..)).)).)))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table