Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA121981 Similarity: 0.962 Similarity: 0.962 Similarity: 0.962
UTR: 5HSAA121981
Gene: ZMYND11
MFE: -28.015
ENS: 0.
Length: 148.
Predicted Ligands:
cobalamin - 7/20
glucosamine - 4/20
molybdenum - 3/20
 RS: URS0002318C8E_1641390
MFE: -23.447
Ligand: cobalamin
Species: Microgenomates bacterium 39_7 Cobalamin riboswitch
 RS: URS0002314CE1_32049
MFE: -35.599
Ligand: cobalamin
Species: Synechococcus sp. PCC 7002 Cobalamin riboswitch
 RS: URS0002317A88_1262786
MFE: -37.644
Ligand: cobalamin
Species: Clostridium sp. CAG:264 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA121981 URS0002318C8E_1641390 URS0002314CE1_32049 URS0002317A88_1262786
Length 148. 147. 147. 147.
Similarity - 0.962 0.962 0.962
Ensemble Norm 0. - - -
MFE -28.015 -23.447 -35.599 -37.644
Ligands - cobalamin cobalamin cobalamin
Gene ZMYND11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 3.005 1.004
Length SE - 1. 1. 1.
Lev Distance - 46. 49. 50.
UBS 8. 10. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 2. 1. 1. 1.
H 4. 5. 5. 4.
BL 2. 3. 2. 2.
BR 2. 3. 1. 2.
UN 0.169 0.184 0.238 0.109

Sequences

Field Description
UTR seq + 25 ugucuacuuuugcaaacugaaagaaaaggauaguaacuuugagucuuguauuugcagacuauugcuuauagguaauaucuauuuuuaauuacagcagacagugagcaagcugacauugcgaggATGGTGATTTTTACATCATTACACA
UTR dot + 25 .((((…..((((((((.((((………….)))).))).)))))…..))))(((((((….)))))))…………….((((.((((……))))…))))…(((((((…….)))))))…..
RS 1 seq UUAAUUCUACAACUGUAUAUUAUGAAUCUAUUAACUAUCAAAAUAUUGGAAGUGGGUGUGAAUCCCACGCUGUGCCGCAACGGUGUUUAAGUUUCCAGUAAAGCUGCAACUUAUCAGUCCGAAACAAGUUUUGACGCUAGAAUAUUA
RS 1 dot ……((((..(((.(((((.(((…………))).))))))))..))))(((((…..)))))…((((…))))…((((((..((((…)))).))))))…(((.(((…..))).)))…………
RS 2 seq UAUAAUUAGACUCUGUUCGGUUUUAUCGGGGAUCAGCCGAUAAAAGCAAUGGGGAAAGAACGGUGCAAAUCCGUCGCUGUCCCGCAGCUGUAAGGAAAUUUUCAGCAAUUUCUAAGUCAGAAUGCCCGCCGAGCCAAGCAUAAACGU
RS 2 dot ……….(((((((.(.(((((((((…….))))))))).))))))))…..((((…….)))).(((((…)))))…..(((((((……)))))))……..((((..((…))…))))……
RS 3 seq UAUGUUCUAUAUUGGAUCUGCUCGGACGUGUCUUUAAAUGUCCGAUCAGGGGGAAAUUCGGUGAGAAUCCGGUGCAACCGCCAUUACUGUGUUAAGAUCAUAAGAUGGUCUUUCAGUCAGAAUACCCGCAGAUUUAUUCUACAUACA
RS 3 dot …(((((.(((((((((((.((((((((……..)))))))).)))……)))))))))))))..((((….))))…((((….((((((((…)))))))).)))).((((((……….))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table